how many times should a restriction enzyme with a recognition of TCGA cut a DNA sequence...
how many times should a restriction enzyme with a recognition of TCGA cut a DNA sequence of 1000 bases?
a) 2
b)4
c) 8
d) 16
e) 32
Homework Answers
The answer is b) 4.
The steps inolved here is,
Step:1: Probability of occurnce of restriction site for TCGA sequence:
As one nitrogen base can occupay in one nucleotide position out of four, the probability of each base is 1/4.
So, the probability of TCGA sequence is 1/4*1/4*1/4*1/4= 1/256.
Step 2: Finding the number of restriction sites for 1000 bases DNA sequence=
No of bases in DNA sequences * probability of restriction site for TCGA sequence
= 1000*1/256 = 3.90 = ~4.
So, the answer is 4.
Add Answer to:
how many times should a restriction enzyme with a recognition of
TCGA cut a DNA sequence...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that...
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone,...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate...
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA...
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA b. Can be used to ligate DNA ends C. Recognizes palindromic DNA sequences d. Cuts random sequences of DNA
Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA b. Can be used to ligate DNA ends C. Recognizes palindromic DNA sequences d. Cuts random sequences of DNA
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
Most questions answered within 3 hours.
-
Which of the following will most likely to happen if Federal
Reserve Bank decreases the money...
asked 14 minutes ago -
You’ve just joined the investment banking firm of Dewey,
Cheatum, and Howe. They’ve offered you two...
asked 8 minutes ago -
An air conditioner cools 226 m^3/min of humid air at 36 oC and
98% relative humidity...
asked 7 minutes ago -
Given P(Ec ) = 0.43, P(F) = 0.52, and P(EF) = 0.18.
Find P( E |...
asked 10 minutes ago -
Consider two empty containers A and B whose volumes are
10mL and 20mL respectively. 1mL of...
asked 13 minutes ago -
Vaughn Manufacturing acquires a coal mine at a cost of $1870000.
Intangible development costs total $354000....
asked 16 minutes ago -
Question 5
What effect would a decrease in
temperature have on pressure, assuming that volume
(T)...
asked 29 minutes ago -
QUESTION 6
Determine the linear momentum of a 2,800 kg houseboat going 3
m/s.
9,100 kg.m/s...
asked 27 minutes ago -
Draw the Lewis dot structures for the following molecules. None
of the atoms have a formal...
asked 33 minutes ago -
Jor-el throws a ball upward from the top of a 728 foot building
on the planet...
asked 31 minutes ago -
What does it mean when an element is radioactive?
a.
It means the element is changing...
asked 34 minutes ago -
A company deposits $6,000 in a bank at the end of every year for
10 years....
asked 33 minutes ago