Homework Answers
A promoter contains -10 box and -35 box. The sequence of -10 box is TATAAT and the sequence of -35 box is TTGACA. A promoter is rich in adenine and thymine.
So option A and C are correct.
Add Answer to:
Which are the sequences in the RNA promoter region? TTGACA AACTGT ТАТААТ ATATTA
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of...
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...
2.Base changes in which of the following can have evolutionary sequences? -Non-coding RNA -mRNA -Promoter sequences...
2.Base changes in which of the following can have evolutionary sequences? -Non-coding RNA -mRNA -Promoter sequences -Protein coding gene -Cis-regulatory module
What are transcription factors? regulatory DNA sequences that bind to the promoter region of a gene...
What are transcription factors? regulatory DNA sequences that bind to the promoter region of a gene regulatory DNA sequences that bind to a protein regulatory motifs that bind to the promoter region of a gene regulatory proteins that bind to specific DNA sequences
Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA...
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a....
Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a. Determine the consensus sequence b. Design an experiment to support the consensus sequence c. Show the predicted results of your experiment
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Which of the following accurately describes the promoter of a gene? a) It is the place...
Which of the following accurately describes the promoter of a gene? a) It is the place on the DNA where RNA polymerase binds. b) It determines which DNA strand of a gene is used as a template. c) It is the first region of DNA that is transcribed into RNA. d) both a and b I think the answer is A but I'm not positive. C cannot be correct because the promoter does not get transcribed, and I don't think...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase)...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase) (2) f. Assume that a fish inherits a deletion mutation in the pituitary switch such that the switch becomes inactive. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect the pituitary switch mutation? (2)
What are two differences between the core promoter and the regulatory promoter for RNA pol II...
What are two differences between the core promoter and the regulatory promoter for RNA pol II of eukaryotes?
Prokaryotic transcription initiation occurs when RNA polymerase binds to promoter region. A hairpin loop is formed....
Prokaryotic transcription initiation occurs when RNA polymerase binds to promoter region. A hairpin loop is formed. Replication forks are created. DNA polymerase binds to promoter region. Flag this Question Question 8 2 pts The movement of genetic information between organisms is termed __________. genetic engineering. transfection. translocation. gene transfer. Flag this Question Question 9 2 pts Heterotrophs cannot synthesize organic molecules on their own. manufacture their own food. include two of the choices. include all the choices. can be chemoheterotrophs....
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...
What are transcription factors? regulatory DNA sequences that bind to the promoter region of a gene regulatory DNA sequences that bind to a protein regulatory motifs that bind to the promoter region of a gene regulatory proteins that bind to specific DNA sequences
Can someone please help me answer these questions. Thank
you!
Eukaryotic transcription signals
a) This drawing shows the placements of the four main sequences of
the eukaryotic core promoter for RNA polymerase II. Identify each
one and give a brief explanation
b) Which sequences are used in a DPE-driven promoter?
c) Which ones are used in a TATA-driven promoter?
d) Please draw and describe the steps as the transcription factors
work with eukaryotic RNA polymerase II to start transcription of...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
son Label the diagram below (A-Protein coding region B-Regulatory switches C-Promoter D. mRNA e. RNA polymerase) (2) f. Assume that a fish inherits a deletion mutation in the pituitary switch such that the switch becomes inactive. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would you expect the pituitary switch mutation? (2)
Most questions answered within 3 hours.
-
The x component of the velocity of an object vibrating
along the x-axis obeys the equation...
asked 4 minutes ago -
A junction box contains two trade size 2 raceways on the left
side, and two trade...
asked 37 minutes ago -
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 1 hour ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 2 hours ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 3 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 5 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 6 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 6 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 8 hours ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 8 hours ago -
5. Problem 11.05 (Discounted Payback)
eBook
Project L costs $60,000, its expected cash inflows are $14,000
per...
asked 8 hours ago -
1. Which of the following is true about politics and health
organizations?
A. Health organizations are...
asked 9 hours ago