Imagine that the DNA sequence adjacent to position 25 on the
diagram below functions as an origin of replication.
A. 5'- UUCGAACACTG -3'
B. Continuous
C. 3'- CAGGGUUUCCA -5'
D. Discontinuous
E. 5'- GUCCCAAAGGU -3'
F. Continuous
G. If upper DNA strand transcribes, 5'- UUAAUAUGUGCUACUUCGAACACUGUCCCAAAGGUUAGUAAUU -3'
If lower DNA strand transcribes, 3'- AAUUAUACACGAUGAAGCUUGUGACAGGGUUUCCAAUCAUUAA- 5'
two RNA molecuels will be produced
Imagine that the DNA sequence adjacent to position 25 on the diagram below functions as an...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Below is a diagram of a DNA molecule that is undergoing bidirectional replication. On the diagram label primers, Okasaki fragments, and the site of action of the enzymes: DNA polymerase III, DNA polymerase III, DNA ligase, DNA helicase and DNA gyrase. Show the polarities (5' rightarrow 3') of the daughter strands. Be sure to label where replication is continuous or discontinuous.
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
The information below represents a change in a portion of the base sequence in a DNA molecule. AOC G A I x-ray, A@CGAT This change can best be interpreted as (1) protein synthesis (2) gene replication (3) nucleic acid replication (4) a gene mutation
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
QUESTION 10 Below is a list of proteins required for DNA replication to occur and functions involved in DNA replication. Match each protein to its function. helicase A catalyzes phosphodiester bonds between two DNA fragments in a strand single strand binding proteins (SSBPs) Rremoves RNA primer and replaces it with DNA topoisomerase cholds DNA polymerase in place during strand elongation - primase D. breaks hydrogen bonds between base pairs and opens the double helix DNA polymerase in E. extends a...
a-F below list the effects on DNA replication that would be
expected in a cell if the gene for one of the following proteins
(i-vi) is mutated and nonfunctional. Write the roman numeral in the
space provided, which corresponds to the expected outcome if that
protein was nonfunctional during attempted DNA replication.
v. DNA ligase vi. DNA sliding clamp A) Primers will be laid down at the origin, but no DNA replication can take place to extend those primers replication...