Why must some of your DNA be replicated in fragments? Please do not focus on how...
Why must some of your DNA be replicated in fragments? Please do not focus on how the DNA is replicated but tell me why some of it must be replicated in fragments.
Homework Answers
DNA replication I'd directionAl it takesplace only in 5'-3' direction which is nothing but the direction of leading strand. Hence the replecation of the other synthesising strand that is lagging strand should takes place in opposite direction that is 3'-5'. But practically in lagging strand orientation 3'-5' replication doesn't occur. Hence DNA lagging strand folds to its back to form a loop at site of replication to cope up with leading strand direction and after finishing a small stretch of replication of lagging strand it unfolds to get its normal 3'-5' orientation and during this time replication pause for a while to leave a gap. After this it again form anot her loop forward to the previous one and replication begins. Like wise lagging strand folds back and forth to produce discontinuous mode of replication in the 5'-3' direction to produce small fragments, on the other hand leading strand shows continous replication to produce single stretch of DNA.
Add Answer to:
Why must some of your DNA be replicated in fragments? Please do
not focus on how...
1 pt 1 Question 1 Why must one strand of DNA be replicated in fragments? DNA...
1 pt 1 Question 1 Why must one strand of DNA be replicated in fragments? DNA polymerase can only add 20 nucleotides in a strand and then must start over ODNA polymerase can only add nucleotides to the 3 hydroxyl of a growing strand O it would be too crowded for two DNA polymerases to be going in the same direction all of the above Question 2 1 pt the DNA would spin and possibly break while being opened in...
What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly...
What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly and some move slowly through an agarose gel? How can type II restriction enzymes and agarose gels be used to identify samples from individuals with the similar DNA sequence?
1. DNA Replication (10 Pts.) Create your own strand of dsDNA being sure to indicate 3’...
1. DNA Replication (10 Pts.) Create your own strand of dsDNA being sure to indicate 3’ and 5’ ends. Tell me how DNA is replicated including how bases pair. Show me DNA replication using your strand (this can be hand drawn). What enzymes are used to actually make the new DNA? How is the DNA primed for replication? What enzyme is responsible for this? What enzyme removes the primer and fills in the gap with DNA? What enzyme covalently bonds...
How do you calculate the average sizes and numbers of DNA fragments produced by digesting human...
How do you calculate the average sizes and numbers of DNA fragments produced by digesting human genomic DNA with a given restriction enzyme?
the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
Describe the process of DNA replication in a well-organized manner. Start with the helicase and go...
Describe the process of DNA replication in a well-organized manner. Start with the helicase and go through the entire process, step by step. Use these terms correctly: Helicase, DNA primase, single stranded binding proteins, DNA polymerase I, DNA Polymerase III, leading strand, lagging strand, okazaki fragments, ligase, topoisomerase, sliding clamp, clamp loader. Please use correct descriptions of the enzyme function. For example, do not say, “seals nicks.” Tell me what “seals nicks” means. If you speak about something you have...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites are there in the DNA? 2) How many molecules of DNA will be present after 6 cycles of PCR, if you started with one double-stranded DNA molecule? CELL BIOLOGY QUESTIONS!! SHOW WORK PLEASE
(blocked) d. PCR amplification of DNA fragments, cluster growth Below are some of the steps that...
(blocked) d. PCR amplification of DNA fragments, cluster
growth
Below are some of the steps that occur in a Nextgen genomic sequencing reaction. Fill in the missing steps. Steps MUST be in the proper order. a. Isolate and fragment genomic DNA from an organism Ev [ Select ] Add primer/ fluorescent chain terminating nucleotides Bind to chip Assemble contig Remove chain terminator Read fluorescence Ligate linkers C e. (Select ] f. Wash away excess, non-bound chain terminating nucleotides [Select] h....
DNA Replication - Describe the process of DNA replication in a well-organized manner. Start with the...
DNA Replication - Describe the process of DNA replication in a well-organized manner. Start with the helicase and go through the entire process, step by step. Use these terms correctly: Helicase, DNA primase, single stranded binding proteins, DNA polymerase I, DNA Polymerase III, leading strand, lagging strand, okazaki fragments, ligase, topoisomerase, sliding clamp, clamp loader. Please use correct descriptions of the enzyme function. For example, do not say, “seals nicks.” Tell me what “seals nicks” means.
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
1 pt 1 Question 1 Why must one strand of DNA be replicated in fragments? DNA polymerase can only add 20 nucleotides in a strand and then must start over ODNA polymerase can only add nucleotides to the 3 hydroxyl of a growing strand O it would be too crowded for two DNA polymerases to be going in the same direction all of the above Question 2 1 pt the DNA would spin and possibly break while being opened in...
the following Sequence of DNA was mixed with an
unknown primer of length 15 BP, ddC, the four NTPs and DNA
polymerase. the resulting mixture of DNA fragments were separated
to provide fragments of lengths 23, 24, 28, and 32 BP amongst
others (other fragments were observed but are not indicated).
indicate below the sequence of the 15 bo primer from 5' to 3'.
please explain how to do this
d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...
(blocked) d. PCR amplification of DNA fragments, cluster
growth
Below are some of the steps that occur in a Nextgen genomic sequencing reaction. Fill in the missing steps. Steps MUST be in the proper order. a. Isolate and fragment genomic DNA from an organism Ev [ Select ] Add primer/ fluorescent chain terminating nucleotides Bind to chip Assemble contig Remove chain terminator Read fluorescence Ligate linkers C e. (Select ] f. Wash away excess, non-bound chain terminating nucleotides [Select] h....
Most questions answered within 3 hours.
-
A 100-W lightbulb has a resistance of about 12 Ω when cold (20
∘C) and 128...
asked 28 seconds ago -
For the asset shown in the following table, use the capital
asset pricing model to find...
asked 1 minute ago -
Which of the following solutes will produce a greater increase
in boiling point when it is...
asked 1 minute ago -
The molarity of a silver nitrate solution is 0.192 M. How many
grams of silver ions...
asked 5 minutes ago -
If the impulse response of a circuit is a pulse y(t) = u(t) –
u(t-T), T...
asked 8 minutes ago -
Eukaryotic cells have __ which is similar to prokaryotes of
Archaea.
A Ester-linked membrane lipids
B...
asked 17 minutes ago -
true or false. If work is done on a system by it's
surroundings, its value is...
asked 21 minutes ago -
Rene Descartes establishes a dualist approach to the world.
Explain this dualism, and how it connects...
asked 27 minutes ago -
According to a recent national Gallup Poll of U.S. smartphone
user, 35% upgrade their cell phone...
asked 31 minutes ago -
Suppose researchers perform a large-sample test of a population
proportion where the null hypothesis is that...
asked 30 minutes ago -
Jessica is single and has taxable income of $305,000 of which
$130,000 is attributable to her...
asked 34 minutes ago -
Can someone help me fill in the first part of this c++ code:
I need it...
asked 37 minutes ago