strand above write the new mRNA and make a mutation then translate it please explain also...
strand above write the new mRNA and make a mutation then translate it please explain also what the mutation did
Homework Answers
5' TAATGCTAGACGTGTTCTAGGA 3' (coding strand) mRNA strand will be same as coding strand except T by U
3 ' ATTACGATCTGCACAAGATCCT 5' (template strand)
5' UAA UGC UAG ACG UGU UCU AGG A 3' mRNA
Stop C Stop T C S R protein sequence has stop codons
the above mentioned sequence is
5' UAA UGC AGA CGU GUU CUA GGA 3'
Stop C R R V L G due to stop codon peptide is not translated
by mutating first residue in the coding DNA to G we gaet the GAA in place of UAA so
the new mRNA is
5' GAA UGC AGA CGU GUU CUA GGA 3'
E C R R V L G protein sequence no stop codons are there so the protein sequence is translated we get a new peptide sequece which have no stop codons incorporated
Add Answer to:
strand above write the new mRNA and make a mutation then
translate it please explain also...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with...
Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with the red one) b. Transcribe the replicated mutated strand to mRNA c. Translate the mRNA produced above to an amino acid sequence: d. What kind of mutation is this?
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from...
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’
One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...
please help ! What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check...
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence provided in the old DNA strand. Old Strand: ATGGCTTAAGCCT O UACCGAAUUCGGA TACCGAATTCGGA O CGTTAGGCCTAAG CGTTUGGCCTUUG
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with the red one) b. Transcribe the replicated mutated strand to mRNA c. Translate the mRNA produced above to an amino acid sequence: d. What kind of mutation is this?
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
Question 5 (20 points) Make a transcription of the DNA template strand 5- A CATTAGTCA GTA GA CAT-3 a. To an mRNA? b. Read and translate the codons on m-RNA into the appropriate amino acids. c. If a mutation of the 9h base from the 3' end is mutated from an A-adenosine to T-thymine, how does this change the amino acid sequence? Be specific by redoing the problem with this one mutation. In a frame shift mutation, one base is...
please help !
What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG? Check Answer Use the codon table to answer the following questions: THE CODON TABLE SECOND POSITION FIRST POSITION THIRD POSITION 0000000000000000 What would be the second amino acid produced by the DNA strand TACCGA GTCACG (Hint: use the mRNA strand you already coded) Check Answer Value: 1 What would be the third amino acid produced by the DNA strand: TACCGAGTCACG (Hint: use the mRNA strand...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence provided in the old DNA strand. Old Strand: ATGGCTTAAGCCT O UACCGAAUUCGGA TACCGAATTCGGA O CGTTAGGCCTAAG CGTTUGGCCTUUG
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
Most questions answered within 3 hours.
-
what is IoT? How is it being used today? How will it be used in
the...
asked 9 minutes ago -
Please answer the four questions below.
1. If you were going to test a method that...
asked 24 minutes ago -
Provide two or three examples of support he uses to reinforce
his arguments?
The Alienation of...
asked 32 minutes ago -
QUESTION 1
Why do we see terms with multiple names in the database
community?
Consistency is...
asked 27 minutes ago -
In a titration experiment, 11.5 mL of 0.400 M H2SO4 neutralized
48.0 mL of NaOH. What...
asked 31 minutes ago -
A shot-putter throws the shot with a horizontal velocity of 10
m/s and a
vertical velocity...
asked 47 minutes ago -
Mildred sells industrial-sized refrigeration units. Her
prospective buyer's face looks tense, and his forehead is wrinkled....
asked 48 minutes ago -
Clark Heter is an industrial engineer at Lyons Products. He
would like to determine whether there...
asked 1 hour ago -
3. Use a text editor to create a comma-delimited file of user
IDs and passwords. Revise...
asked 1 hour ago -
Jensen and Associates has a projected balance
sheet that includes the following accounts. What is the...
asked 1 hour ago -
implement a doubly-linked list in C. Each node in the linked list should contain a string,...
asked 1 hour ago -
What are some best practices and things to avoid when developing
a PowerPoint presentation or file
asked 1 hour ago