Peptides isolated from rapeseed that may lower blood pressure have the following sequence of amino acids....
Peptides isolated from rapeseed that may lower blood pressure have the following sequence of amino acids.
Draw the structure for Arg-Ile-Tyr. (Express your answer as a zwitterion.
Draw the structure for Val-Trp-Ile-Ser. (Express your answer as a zwitterion.)
Homework Answers
Add Answer to:
Peptides isolated from rapeseed that may lower blood
pressure have the following sequence of amino acids....
How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino...
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
A strain of yeast translates mRNA into protein with a high level of inaccuracy. Individual molecules...
A strain of yeast translates mRNA into protein with a high level of inaccuracy. Individual molecules of a particular protein isolated from this yeast have the following variations in the first 11 amino acids compared with the sequence of the same protein isolated from normal yeast cells normal sequence Met Trp Ala Ile Val Ser Trp Thr Gin Ile Lys variants Met Cys Ala Ile Val Ser Trp Thr Gln Ile Lys Met Trp Ala Ile Val Ser Cys Thr...
Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...
Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids: A. Arg and His B. His and Asp C. Tyr and Gly D. Phe and Trp E. Val and Asn
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
"A protein is made from a messenger RNA of the following sequence. What is the sequence...
"A protein is made from a messenger RNA of the following sequence. What is the sequence of amino acids for this protein? (Remember, a start and a stop codon are needed for a protein to be made). 3' G C C G A U G G A U G A A G U U U U A A A G U A A U A G C A A U G G A G G A C 5'" (amino) met...
How many amino acids are there in the disease causing variant of
the Amyloid-beta (Ab) peptide?
Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
Need help with #2
Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...
repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg
Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...
A strain of yeast translates mRNA into protein with a high level of inaccuracy. Individual molecules of a particular protein isolated from this yeast have the following variations in the first 11 amino acids compared with the sequence of the same protein isolated from normal yeast cells normal sequence Met Trp Ala Ile Val Ser Trp Thr Gin Ile Lys variants Met Cys Ala Ile Val Ser Trp Thr Gln Ile Lys Met Trp Ala Ile Val Ser Cys Thr...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
Most questions answered within 3 hours.
-
Which of the following best describes tidal volume? options:
1.The amount of oxygen in the air...
asked 5 minutes ago -
1. Smaller cost distortions occur when the traditional systems'
single indirect-cost rate and the activity-cost-driver rates:...
asked 13 minutes ago -
Using either a FMECA approach or some other appropriate RCA
tool, identify five risk treatment actions...
asked 13 minutes ago -
If for a test the P-value is between 0.0025 and 0.005, what
conclusion can you draw?...
asked 26 minutes ago -
Using Python. Write a function clean2(aList) that takes a list
of integers aList as argument, and...
asked 31 minutes ago -
Intrapreneurship is defined as the
development of an enterprise culture with an existing (Nandan,
2009). An...
asked 45 minutes ago -
QUESTION 1 Tamiflu is a drug used to treat influenza. A study
found that Tamiflu reduced...
asked 49 minutes ago -
Which of the following would be less likely to be used to
allocate factory overhead when...
asked 55 minutes ago -
Transverse pulses travel with a speed of 195 m/s along a taut
copper wire whose diameter...
asked 54 minutes ago -
Sampling for Engineers Homework question 11.51
Suppose that Y1;Y2;Y3;Y4 denote a random sample from a
Poisson(θ)...
asked 57 minutes ago -
Which of the following is cleaved by regulated intramembrane
proteolysis (RIP)? Select any/all answers that apply....
asked 56 minutes ago -
Random characters You decide to create a program characters.py
that fills a two-dimensional list with random...
asked 1 hour ago