can someone check my work? A ribosome can have as many as three tRNAs associated with...
A ribosome can have as many as three tRNAs associated with it at any given time during translation. Match the following statements with the site in the ribosome where they occur. [Choose ] The initiator tRNA is special because it is the only tRNA that can initially bind at this site in the ribosome. [Choose ] During the elongation stage of translation, new tRNAs enter at which site? [Choose] Peptidyltransferase is the ribozyme that transfers the growing peptide chain from...
Question 5 -- / 1 There are different amino acids, and possible codons. 1 3; 20 2 3; 64 3 20; 3 4) 20; 64 5) 64; 3 6 64; 20 Question 6 -- / 1 Which of the following contains an open reading frame (consider the given strand only)? 1 AUGCCCGGGCGAGAC UAUGCGCAACCUGAG N 3 AAAUGAUGACCCAAA 4 UAUGCCGUCGUGAGG 5 UGAUUUCCCGGGCAA Which of the following is true? The initiator tRNA starts in the A site of the ribosome during translation initiation,...
During the ‘elongation’ stage of translation, after the arrival of each new tRNA: A. the amino acid is ‘passed’ from the tRNA in the A site to the tRNA in the P site. B. newly arriving tRNAs must first bind to the E-site. C. the peptide is ‘passed’ from the tRNA in the P site to the tRNA in the A site. D. the new tRNA must first bind to the P-site of the ribosome Hi, i need help with...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...
15. Translation (RNA protein) has three main stages: initiation, elongation, and termination. a. Initiation occurs when the small ___________________ subunit binds to the ____ end of mRNA and is then joined by the large _________________ subunit (which has three sites called the A, P, and E sites). Once the complex is formed, the _______________ begins to read the mRNA in a ____ to ____ direction. When it reaches the first start codon (_________) a tRNA carrying the amino acid ______________________...
BIOLOGY QUESTION Ribosomes are important complexes during translation. Choose all the answers below that are associated with ribosomes: assembled from rRNA and proteins catalyze the attachment of an amino acid to a tRNA contain three distinct sites where tRNA bind bind to mRNA O act as a ribozyme to catalyze formation of a peptide bond need additional translational protein factors for initiation, elongation and release catalyze the formation of phosphodiester bonds
I need help answering this question please! x G are stop codons adn terminati x+ ■ Course Content A Test Information Instructions Multiple Attempts This test allows 3 attempts. This is attempt number 1. Force Completion This test can be saved and resumed later Question Completion Status: & Moving to another question will save this response. Question 4 Which of the following does not occur during termination of translation? The tRNA corresponding to the stop codon enters the A site...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
Multiple types of RNAs are involved in translation. Choose the all the types of RNAs and their functions in translation. a. mRNAs are templates that provide coding information to form proteins b. rRNAs are ribozymes that catalyze the addition of amino acids. c. mRNAs are adaptor molecules that contain amino acids. d. tRNAs are ribozymes that catalyze the addition of amino acids. e.rRNAs are templates that provide coding information to form proteins. O f. tRNAs are adaptor molecules that contain...