Identify the best translation start site in the mRNA below: 5’ AUGGCUUAUGCUCGTCCGCCAUGGCUUUAAGUACGGUAAAUGCUACA 3’
Identify the best translation start site in the mRNA below:
5’ AUGGCUUAUGCUCGTCCGCCAUGGCUUUAAGUACGGUAAAUGCUACA 3’
Homework Answers
Usually the start site in mRNA (messenger RNA) is the first codon. The start codon always encode for methionine in Eukaryotes and Archaea except in bacteria where there is modified methionine (fMet). Most common start site is AUG.
So the first three sequence starting from 5’ AUG..... is the best translation start site in the given sequence here
Add Answer to:
Identify the best translation start site in the mRNA below:
5’
AUGGCUUAUGCUCGTCCGCCAUGGCUUUAAGUACGGUAAAUGCUACA 3’
Which of the following statements best describes the initiation of translation? A tRNA with the anticodon,...
Which of the following statements best describes the initiation of translation? A tRNA with the anticodon, AUG, enters the ribosomal complex and binds to the mRNA at the A site. b) The large and small ribosomal subunits scan the mRNA in the 3'-5 direction until the promoter is reached. The mRNA containing the start codon, AUG, sits at the P site and forms a complex with the corresponding tRNA, and the large and small ribosomal subunits. d) The mRNA attaches...
choose the correct answer 26. In eukaryotes, but not in prokaryotes, ribosomes find the start site...
choose the correct answer
26. In eukaryotes, but not in prokaryotes, ribosomes find the start site of translation by? a. binding directly to a ribosome-binding site preceding the initiation codon b. scanning along the mRNA from the 5' end c. recognizing an AUG codon as the start of translation. d. binding an initiator tRNA 27. Which of the following statements about prokaryotic mRNA molecules is FALSE? a. A single prokaryotic mRNA molecule can be translated into several proteins b. Ribosomes...
In the diagram below find • 1. mRNA • 2. tRNA . 3. polypeptide B С...
In the diagram below find • 1. mRNA • 2. tRNA . 3. polypeptide B С A D PA MANGAN Start codon Stop codon In the following diagram of translation find: 4. 30S ribosomal subunit 5. RNA 6. mRNA 7. Amino acid 8. A site 9. Anticodon 10. Start codon A G D H AUG E B
In the folldwing diagram of translation find: А 4. 30S ribosomal subunit 5. URNA 6. mRNA...
In the folldwing diagram of translation find: А 4. 30S ribosomal subunit 5. URNA 6. mRNA 7. Amino acid 8. A site 9. Anticodon 10. Start codon Me G Met D с F H AUGUUA AUG w B E
How does a ribosome identify mRNA for translation from the rest of the RNA species in...
How does a ribosome identify mRNA for translation from the rest of the RNA species in the cell?
The piece of eukaryotic mRNA below includes the region that codes for the binding site for...
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5GUU UCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? 88883 aឱ88 - GAC AAC UGC GNU ANU UGU GAG Ala Arg Asp Asn cys Glu Gin Gly is the low lys Met Phe Pro Ser The Trp...
The piece of DNA below encodes the initial part of a mRNA that includes the region...
The piece of DNA below encodes the initial part of a mRNA that includes the region that is the binding site for the initiator tRNA needed in translation: 5- promoter --GTTCCCGTATACATGCCCGCTGGGGGC-3' ------CAAGGGCATATGTACGCACGACCCCCG-5’ Which amino acid will be on the tRNA that is the first to bind to the A-site of the ribosome?
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A) site of the ribosome Aminoacyltransferase attaches the amino...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site. The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A site of the ribosome. Aminoacyltransferase attaches the amino...
Which of the following statements best describes the initiation of translation? A tRNA with the anticodon, AUG, enters the ribosomal complex and binds to the mRNA at the A site. b) The large and small ribosomal subunits scan the mRNA in the 3'-5 direction until the promoter is reached. The mRNA containing the start codon, AUG, sits at the P site and forms a complex with the corresponding tRNA, and the large and small ribosomal subunits. d) The mRNA attaches...
choose the correct answer
26. In eukaryotes, but not in prokaryotes, ribosomes find the start site of translation by? a. binding directly to a ribosome-binding site preceding the initiation codon b. scanning along the mRNA from the 5' end c. recognizing an AUG codon as the start of translation. d. binding an initiator tRNA 27. Which of the following statements about prokaryotic mRNA molecules is FALSE? a. A single prokaryotic mRNA molecule can be translated into several proteins b. Ribosomes...
In the diagram below find • 1. mRNA • 2. tRNA . 3. polypeptide B С A D PA MANGAN Start codon Stop codon In the following diagram of translation find: 4. 30S ribosomal subunit 5. RNA 6. mRNA 7. Amino acid 8. A site 9. Anticodon 10. Start codon A G D H AUG E B
In the folldwing diagram of translation find: А 4. 30S ribosomal subunit 5. URNA 6. mRNA 7. Amino acid 8. A site 9. Anticodon 10. Start codon Me G Met D с F H AUGUUA AUG w B E
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5GUU UCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? 88883 aឱ88 - GAC AAC UGC GNU ANU UGU GAG Ala Arg Asp Asn cys Glu Gin Gly is the low lys Met Phe Pro Ser The Trp...
The piece of DNA below encodes the initial part of a mRNA that includes the region that is the binding site for the initiator tRNA needed in translation: 5- promoter --GTTCCCGTATACATGCCCGCTGGGGGC-3' ------CAAGGGCATATGTACGCACGACCCCCG-5’ Which amino acid will be on the tRNA that is the first to bind to the A-site of the ribosome?
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A) site of the ribosome Aminoacyltransferase attaches the amino...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site. The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A site of the ribosome. Aminoacyltransferase attaches the amino...
Most questions answered within 3 hours.
-
Based on how much or how little you have noticed in the media,
do you think...
asked 2 hours ago -
I calculate Rosetta Stone’s P/E ratio as 10x prior to a report
about future industry growth....
asked 3 hours ago -
What major physiological changes account for electrodermal
activity (as in during a lie-detector test)?
asked 4 hours ago -
You are going to sell fruits & vegetables at a local
roadside market. List separately and...
asked 4 hours ago -
Hows does water affect the digestion of fats ?
asked 7 hours ago -
A buffer that contains 0.41 M of a base, B and 0.21 M of its
conjugate...
asked 7 hours ago -
Pleaaaaaaaasssssse help me please please it's more important
:((((((((((((((((((((
CASE STUDY
Nissan Company
Nissan Motor Company,...
asked 7 hours ago -
Calculate the concentration of hydronium and hyroxide ions in 1)
2.0 mol/L HNO3 2) 0.5 mol/L...
asked 7 hours ago -
In a loop-the-loop ride a car goes around a vertical, circular
loop at a constant speed....
asked 7 hours ago -
50 grams each of water (18.015 g/mol) and ethylene glycol
(C2H6O2) (62.07 g/mol) are mixed. At...
asked 7 hours ago -
The life expectancy of sport utility vehicles follows a normal
distribution with a mean of 145.8...
asked 8 hours ago -
If an object with mass of 5 kg is pushed with a force of 552 N,...
asked 7 hours ago