How come DNA polymerase 1 I can remove primers but DNA polymerase 2 I cannot?
How come DNA polymerase 1 I can remove primers but DNA polymerase 2 I cannot?
Homework Answers
The DNA polymerase are enzymes that create DNA molecules by assembling nucleotides, the building blocks of DNA. These enzymes are essential to DNA replication and usually work in pairs to create two identical DNA stands from a single orginal DNA molecules. The only role of DNA polymerase 1 is to hydrolyse the RNA primer and fill in the gaps with complementary deoxyribonucleoside triphosphate and the end of DNA replication. Bacteria have only a single site on their chromosome where DNA synthesis begins, while higher organism's like humans have several on each of their chromosome where DNA systhesis begins, while higher organism like humans have several on each of their chromosomes. Once DNA helicase binds to the DNA , it separates the two strands this allow DNA polymerase 1 to attach and begin copiying the DNA.
DNA polymerase 2 is a prokaryotic DNA dependent DNA polymerase encoded by the Po1B Gene. DNA polymerase 2 is an 89.9k Da protein and is a member of the B family of DNA polymerase.
A damaged sequence of DNA can cause replication to be stalled. In order to fix an error in the sequence , DNA pol 2 catalyzes the repair of nucleotide base pairs. The N terminal domain of DNA pol 2 is responsible for the DNA stand to the catalytic subunits.
Add Answer to:
How come DNA polymerase 1 I can remove primers but DNA
polymerase 2 I cannot?
Describe the roles of DNA polymerase I, DNA polymerase III, gyrase, helicase, primase, and ligase in...
Describe the roles of DNA polymerase I, DNA polymerase III, gyrase, helicase, primase, and ligase in the replication of E. coli DNA. What features of the E. coli replisome and of DNA polymerase III’s structure are associated with replication processivity? How do mammalian cells prime discontinuous strand replication and how do they remove RNA primers?
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The...
PCR utilizes specific DNA primers and polymerase enzyme to make copies of particular DNA sequence. The primers must attach to separated DNA at the target sequences so that the polymerase can build new DNA strands. What must also be added to the mixture besides primers and polymerase enzyme in order to get amplification and DNA? a. RNA polymerase b. dNTPs c. electron carriers d. DNA repair enzymes
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers...
In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers (5’ ACTGA 3’) are added to a test tube. A template strand of DNA is shown below. How many fragments of different lengths would you have at the end of the sequencing process? (write down the sequence of each fragment and the length of the fragment for full credit) DNA Sequence 3’ TGACTCTAGCCTAGGACTATATCG 5’
Which of the following statements about DNA replication is FALSE? Primase synthesizes the primers. DNA polymerase...
Which of the following statements about DNA replication is FALSE? Primase synthesizes the primers. DNA polymerase is required to add new nucleotides to the growing ends of the DNA strands. DNA ligase joins the small DNA fragments of the lagging strand. Only one strand of the parent DNA serves as a template for a newly synthesized complementary strand.
Primers are short pieces of DNA that are used in PCR (Polymerase Chain Reaction), the process...
Primers are short pieces of DNA that are used in PCR (Polymerase Chain Reaction), the process which is used in molecular labs to make copies of short stretches of a gene or genome. You have designed primes that have a Molecular Weight (MW) of 6000. It arrives as a dry sample in the quantity of 300 µg. How much water do you need to add to make a primer stock solution of 100 mM primers? HINTS: Remember that mM is...
Which of the following statements is correct? (Points : 2) DNA polymerase requires a primer to...
Which of the following statements is correct? (Points : 2) DNA polymerase requires a primer to get started. RNA polymerase requires a primer to get started. Both DNA and RNA polymerase require primers to get started. Both DNA and RNA polymerase can start synthesis de novo
Which of the following statements about eukaryotic DNA replication is false? A) DNA polymerase can add...
Which of the following statements about eukaryotic DNA replication is false? A) DNA polymerase can add new nucleotides to either free 3'- or 5'-end B) RNA primers must be removed and rejected by the deoxynucleotides C) RNA primers must be laid down during DNA replication for synthesis of new DNA that starts at the 3'-OH of the primer ends D) Elongation of the DNA strand during replication requires primers with free 3'OH end E) The very end of the chromosome...
1. If you were trying to come up with an easy-to-remember analogy for the polymerase chain...
1. If you were trying to come up with an easy-to-remember analogy for the polymerase chain reaction, you would likely say PCR is similar to a colored pencils scissors dishwasher photocopier 2. What determines the piece of DNA that is amplified in PCR? The specific primers used The source of the DNA The temperature of each cycle The specific restriction enzyme used 3. What is the role of temperature in PCR? It is used to separate and anneal the nucleic...
Please answer the following questions about primers: a) Explain how the primers are made for the...
Please answer the following questions about primers: a) Explain how the primers are made for the Sanger sequencing when we even don't know the sequence of the DNA yet ? b) Do all cells in the body have the same primer and starting site for the DNA polymerase ? Do all primers have an idetical base sequence ? Is the same set of primers used for both leading and lagging strands ? c) Are primers made of DNA or RNA...
The cell must remove and replace an RNA primer with DNA, if DNA pol I was...
The cell must remove and replace an RNA primer with DNA, if DNA pol I was the only enzyme available to do this, which activities must it use? a. 3'-5' exonuclease and 5'-3' polymerase b. 5'-3' exonuclease and 5'-3' polymerase c. 5'-3' exonuclease and 3'-5' polymerase d. 3'-5' exonuclease and 3'-5' polymerase
1. If you were trying to come up with an easy-to-remember analogy for the polymerase chain reaction, you would likely say PCR is similar to a colored pencils scissors dishwasher photocopier 2. What determines the piece of DNA that is amplified in PCR? The specific primers used The source of the DNA The temperature of each cycle The specific restriction enzyme used 3. What is the role of temperature in PCR? It is used to separate and anneal the nucleic...
Most questions answered within 3 hours.
-
11.53g sample of NaBr contains 22.34% Na by mass Considering
the law of constant composition how...
asked 18 minutes ago -
Exercise 5-22A Complete the accounting cycle using receivable
transactions (LO5–1, 5–2, 5–4, 5–5, 5–7) [The following...
asked 50 minutes ago -
Do you agree with the view that small businesses are more
vulnerable to employee theft because...
asked 1 hour ago -
Four forces act on an object, given by A = 41.3 N east, B = 46.3...
asked 1 hour ago -
Which of the following design considerations leads to more
user-friendly presentation layers for GUIs? [Check all...
asked 2 hours ago -
38%
of adults say cashews are their favorite kind of nut. You
randomly select 12 adults...
asked 4 hours ago -
Notational Inc. is considering installing a new server. The
machine costs $100,000 and is expected to...
asked 4 hours ago -
Given the information coding of DNA strand:
5'-TTT-TAC-GAA-GAG-TGA-3',
Write the corresponding DNA template and mRNA strand...
asked 5 hours ago -
2. Boris recently synthesized an explosive compound he named
Badenoughium. The molecular formula for Bdenoughium is...
asked 8 hours ago -
5. A car decelerate evenly from a velocity of 50mph until rest
in a distance of...
asked 8 hours ago -
IN HTML Programming
1. Write a script that inputs integers (one at a time) and
passes...
asked 9 hours ago -
A dentist uses a mirror to examine a tooth that is 0.75 cm in
front of...
asked 9 hours ago