Question

Return 23 Subm 3 points In the image below, the long line across the center is a DNA strand, and the shorter "strings" are RNA molecules being transcribed from that DNA. Are the RNA polymerase molecules moving from right to left or left to right? How do you know? im Figure 7-8 Essen Cell Biology Garland Science 2010) BI A - A - Ix E 21 x x : 12pt Paragraph - VIKI Rakuten

Answer 1

I believe the correct answer to be:

23) left to right.

As the fragments to the right are clearly larger in size which indicates that the polymerase has been synthesizing mRNA for a longer time when compared to smaller fragments on the left which indicates it is moving from left to right.

24) 5' CGAGGUAUGCCAACGUGCGUCUAAUCCCGA 3'

As the coding strand is exactly the same as mRNA strand because the complementary template strand is used to synthesize the mRNA fragment. T is replaced by U in case of RNAs.