Assuming that a DNA sequence has equal number of four bases, What would be the average...
Homework Answers
Answer:
The average size of the pieces formed by cutting the DNA with EcoR1 restriction enzyme: 4096 basepairs long
Recognition sequence of EcoR1: GAATTC
Frequency of EcoR1 site in a sequence of nucleotide: for every 4096 basepairs
Method:
DNA has 4 nucleotides (A, T, G, C) and the recognition site is 6 nucleotides long.
So 46 = 4096 bp long.
Add Answer to:
Assuming that a DNA sequence has equal number of four bases,
What would be the average...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
Help with these two would be appreciated JUVIJVVEL In a large unbiased random DNA sequence, how...
Help with these two would be
appreciated
JUVIJVVEL In a large unbiased random DNA sequence, how often would you expect a 6 base targeting site specific restriction enzyme to cut? O On average every 4096 base pairs (446) O Never O On average every 1.296 base pairs (6^4) O Every 6 base pairs QUESTION 5 2 points Save Answer How do bacteria possessing restriction systems avoid targeting and cutting their own DNA? By methylating their chromosomal DNA O By methylating...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
15. A new bacterial species was found and its DNA was analysed. It has a 50%...
15. A new bacterial species was found and its DNA was analysed. It has a 50% G+C content. Complete the table below by filling in the average length of restriction fragments expected from the genomic DNA (assuming a random distribution of bases) if it were digested with the following four restriction enzymes. (4 marks) The " symbol indicates the location of the cleavage site. Assume 50% G+C Restriction Enzyme Sequence recognized Average length of restriction fragment (base pairs) Msp 1...
One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
6. Consider the enzyme HindIII cutting a DNA molecule of 40% GC a) What sequence does this...
6. Consider the enzyme HindIII cutting a DNA molecule of 40% GC a) What sequence does this enzyme recognise? b) What proportion of this DNA is made up of adenine bases? c) How often would HindIII cut this molecule (in bp)? d) If this DNA molecule was 21,000 bp in length, how many fragments would be produced on average? Could you please explain your reasoning for the answers so that i may actually understand it. so far I know HindIII enzyme recognises AAGCTT, but...
You've identified and purified a novel closed circular viral DNA, and want to treat it with a typ...
You've identified and purified a novel closed circular viral DNA, and want to treat it with a type II restriction enzyme used in BCH370. This DNA has a single restriction site contained within the following sequence: 5' GGGTTATGAATTCTACA 3' 3, CCCAATACTTAAGATGT 5, a) Indicate the probable region identified by the restriction enzyme, and explain how you can identify the recognition sequence based on certain criteria. (2 marks) b) You then attempt to identify whether or not the viral vector contains...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
Help with these two would be
appreciated
JUVIJVVEL In a large unbiased random DNA sequence, how often would you expect a 6 base targeting site specific restriction enzyme to cut? O On average every 4096 base pairs (446) O Never O On average every 1.296 base pairs (6^4) O Every 6 base pairs QUESTION 5 2 points Save Answer How do bacteria possessing restriction systems avoid targeting and cutting their own DNA? By methylating their chromosomal DNA O By methylating...
15. A new bacterial species was found and its DNA was analysed. It has a 50% G+C content. Complete the table below by filling in the average length of restriction fragments expected from the genomic DNA (assuming a random distribution of bases) if it were digested with the following four restriction enzymes. (4 marks) The " symbol indicates the location of the cleavage site. Assume 50% G+C Restriction Enzyme Sequence recognized Average length of restriction fragment (base pairs) Msp 1...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
You've identified and purified a novel closed circular viral DNA, and want to treat it with a type II restriction enzyme used in BCH370. This DNA has a single restriction site contained within the following sequence: 5' GGGTTATGAATTCTACA 3' 3, CCCAATACTTAAGATGT 5, a) Indicate the probable region identified by the restriction enzyme, and explain how you can identify the recognition sequence based on certain criteria. (2 marks) b) You then attempt to identify whether or not the viral vector contains...
Most questions answered within 3 hours.
-
The outstanding bonds of Alpha Extracts have a yield to maturity
of 7.4 percent and a...
asked 20 minutes ago -
A 8.15- g bullet from a 9-mm pistol has a velocity of 366.0 m/s.
It strikes...
asked 23 minutes ago -
The Problem: The Case of the Harmonizing Vacations
Your CEO is exploring partnering with a European...
asked 1 hour ago -
A chemical equation is balanced by adding coefficients in front
of some formulas so that the...
asked 1 hour ago -
From the literature (reference your sources): What are the
lattice parameters of calcite and aragonite? Why...
asked 2 hours ago -
Your system is rejecting the question am asking which is
preceded by a case study. It...
asked 2 hours ago -
3. On January 2, 2000, Larry creates a trust with himself as
trustee. Larry as trustee...
asked 2 hours ago -
A member of the volleyball team spikes the ball. During this
process, she changes the velocity...
asked 2 hours ago -
Are adult gamers less likely to use a gaming console (Xbox,
PlayStation, Wii, etc...) than teen...
asked 3 hours ago -
The University of
Texas recently reported that 43% of college students aged 18-24
would spend their...
asked 3 hours ago -
The length of stay at a specific emergency department in
Phoenix, Arizona, in 2009 had a...
asked 2 hours ago -
. Please give the mechanism for this type of problem. Step by
Step
The toxin that...
asked 2 hours ago