Homework Answers
The template strand is read in either 5' to 3' direction or 3' to 5' direction.
Reason: For DNA synthesis, the reading frame is in 5' to 3' direction. This is because DNA polymerase synthesises new strand only in 5' to 3' direction. For RNA synthesis, the reading frame is 3' to 5' direction. Here, RNA polymerase reads the template strand only when it is oriented in 3' to 5' direction and the mRNA is synthesised in 5' to 3' direction.
Add Answer to:
The template strand of DNA is read Select one: O O O either 5' to 3'...
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand...
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Would the DNA strand indicated with an arrow in the figure below serve as a template...
Would the DNA strand indicated with an arrow in the figure below serve as a template for a leading or a lagging DNA strand? ان TTTTTTTTTTTT- کی 73% Select one a lagging Strand b. Leading Strand o © Type here to search * 00
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read?...
1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read? 2. How are new nucleotide monomers attached to the growing strand? What is the reaction that takes place? How is dATP different from ATP? 3. Why does the lagging strand exist? 4. In the lagging strand, what is the enzyme that replaces the RNA primer with DNA? What enzyme then connects the two fragments together? 5. The replication machinery is very accurate but every...
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a...
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a DNA primer? 5' CATAGTACAAGG 3' 5'AGTATAGTGTTA 3' O 5' TAACACTATACT 3' O No one of these primers recognise the given template O 5'CCTTGTACTATG 3'
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT...
DNA sequence of a one strand of a gene to be transcribed is: 3’ — AGTCCGATGGGCT GA — 5’ the sequence of the MRNA is: 3’ — AGUCCGAUGGGCTGA — 5’ the sequence of the DNA strand shown above is that of the: a. template strand b. coding strand
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand....
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Would the DNA strand indicated with an arrow in the figure below serve as a template for a leading or a lagging DNA strand? ان TTTTTTTTTTTT- کی 73% Select one a lagging Strand b. Leading Strand o © Type here to search * 00
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a DNA primer? 5' CATAGTACAAGG 3' 5'AGTATAGTGTTA 3' O 5' TAACACTATACT 3' O No one of these primers recognise the given template O 5'CCTTGTACTATG 3'
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
Most questions answered within 3 hours.
-
Starting with benzene, synthesize 1-phenyl-1-butyne.
Show intermediates and reagents.
asked 23 minutes ago -
Create a 32-run crossed array design with six control factors
and two noise factors such that...
asked 1 hour ago -
A 500g sample of sand from source A has the following amounts
retained on each sieve....
asked 1 hour ago -
In
your own words, please explain the essay by John Keynes wrote "The
End of Laissez...
asked 1 hour ago -
How are the matrix and pixels related? Why are smaller
pixels better for diagnostic quality?
asked 1 hour ago -
2. An AC generator has 80 rectangular loops on
its armature. Each loop is 11 cm...
asked 1 hour ago -
Please help me with this question. Consider Aldi’s current and
potential geographic markets (see Exhibit 4...
asked 1 hour ago -
What are the main components of the fermentation process and
give an explanation of each? Include...
asked 1 hour ago -
Explain which types of cells in the body (belonging to which
organs, etc.) are sensitive to...
asked 1 hour ago -
A single cable supports an 703-kg elevator car. What is the
tension in the cable when...
asked 1 hour ago -
among the three different ways to link CSS specifications to an
HTML document (inline CSS, document...
asked 2 hours ago -
(1) Write the net ionic equation for the reaction that occurs
when equal volumes of 0.191...
asked 2 hours ago