Question

QUESTION 1 Translate the following E.coli mRNA into a polypeptide. 5.UCUA GAU UAUGCAAGCCUULIACGIJAAGCUUACGC-3 T T T Arial 3 (12pt) QUESTION 2 Translate the following human mRNA into a polypeptide. UAUGUGAUCAUAGC-3 3 (12pt) points save Answer 2 points Save Answer Words
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Question 1: UCUAUGGAGGAGGAUCGAUUAUGCAAGCCUUUACGUAAGCUUACGC

We can use Translate tool from Expasy (http://web.expasy.org/translate/). This tool shows all six possible combinations.

5'3' Frame 1
tct atg gag gag gat cga tta tgc aag cct tta cgt aag ctt acg c

 S M  E  E  D  R  L  C  K  P  L  R  K  L  T      

5'3' Frame 2
tctatggaggaggatcgattatgcaagcctttacgtaagcttacgc

  L  W  R  R  I  D  Y  A  S  L  Y  V  S  L  R  

5'3' Frame 3
tctatggaggaggatcgattatgcaagcctttacgtaagcttacgc

   Y  G  G  G  S  I  M  Q  A  F  T  -  A  Y    

3'5' Frame 1
gcgtaagcttacgtaaaggcttgcataatcgatcctcctccataga

 A  -  A  Y  V  K  A  C  I  I  D  P  P  P  -    

3'5' Frame 2
gcgtaagcttacgtaaaggcttgcataatcgatcctcctccataga

  R  K  L  T  -  R  L  A  -  S  I  L  L  H  R  

3'5' Frame 3
gcgtaagcttacgtaaaggcttgcataatcgatcctcctccataga

   V  S  L  R  K  G  L  H  N  R  S  S  S  I    

Since the first amino acid should be methionine (M) the correct frame is 5'3' Frame 1 and the sequence of amino acids is M E E D R L C K P L R K L T

Question 2: UACGAGUAAGUCAGUGACAGAUGGAGGAUAUGUGAUCAUAGC

Using Translate tool

5'3' Frame 1

tacgagtaagtcagtgacagatggaggatatgtgatcatagc

 Y  E  -  V  S  D  R  W  R  I  C  D  H  S  

5'3' Frame 2
tacgagtaagtcagtgacagatggaggatatgtgatcatagc

  T  S  K  S  V  T  D  G  G  Y  V  I  I    

5'3' Frame 3
tacgagtaagtcagtgacagatggaggatatgtgatcatagc

   R  V  S  Q  -  Q  M  E  D  M  -  S  -    

3'5' Frame 1
gctatgatcacatatcctccatctgtcactgacttactcgta

 A  M  I  T  Y  P  P  S  V  T  D  L  L  V    

3'5' Frame 2
gctatgatcacatatcctccatctgtcactgacttactcgta

  L  -  S  H  I  L  H  L  S  L  T  Y  S    

3'5' Frame 3
gctatgatcacatatcctccatctgtcactgacttactcgta

   Y  D  H  I  S  S  I  C  H  -  L  T  R   

So the correct frame is 3'5' Frame 1 and the amino acid sequence is  M I T Y P P S V T D L L V

Please use expasy yourself to learn more. All the best.

Add a comment
Know the answer?
Add Answer to:
Translate the following E.coli mRNA into a polypeptide. Translate the following human mRNA into a polypeptide.
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT