If you cut a circular plasmid with enzyme A that shows 2 enzyme A (A1 and A2) marked with specific base pairs, is the 0 rest mark also considered as a band? If there is enzyme A1 and enzyme A2 on a plasmid, are there 2 bands or 3?
If there is a circular plasmid containing two types of restriction sites for enzyme A1 and A2, and they are cut with these two enzymes, and assuming they have only one site each...then there will be 2 bands formed.
Now, if you will see the below picture, you will know how three bands are formed from a cirular band
If your meaning of saying the 0 mark on plasmid is also a band, then yes..there will be two bands for it, one will be having 0 mark for it
Hope it helps, Good luck !!!!
PLEASE DO PRESS LIKE :)
If you cut a circular plasmid with enzyme A that shows 2 enzyme A (A1 and...
An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1, 3 and 5 kb are seen. How many EcoRI sites are in the plasmid? Choose the one answer that is most correct. Group of answer choices: At least 2, At least 3, At least 5, None, At least 1, At least 4
10 please and 7
You isolate plasmid DNA from bacteria (Questions 7-10) 7) A plasmid is an extrachromosomal circular DNA frequently found in prokaryotes. Aside from being smaller, how is it different from the prokaryotic genome? You place equal amounts of plasmid DNA in 4 different tubes and incubate the DNA with increasing amounts of the enzyme topoisomerase I for 1 hour (0 enzyme units 0.25 enzyme units, 0.5 enzyme units and 1 enzyme unit). You then analyze the plasmid...
You cut the pBad-mTagBFP2 plasmid with the BamHI restriction enzyme only. There is only one BamHI RE site. How many bands do you expect to see after you run the product on a gel? Would you expect the same result if you cut a linear PCR product that also only has one cut site? Explain your reasoning
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see on the gel? 2. How would you estimate the total number of base pairs in a plasmid by looking at the DNA fragments of the digested plasmid on a gel? 3. If a linear 1kb DNA fragment has a restriction site that is located 50 bp from one end of the plasmid, what would you expect to see if the digested and undigested DNA...
A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme 1 cuts the plasmid in one place while restriction enzyme 2 cuts in two places. All restriction sites are at least 1kB apart from each other. Based on this information, the resulting gel should have _____ bands for the enzyme 1 reaction, _____ bands for the enzyme 2 reaction, and _____ bands for the reaction that contains both enzymes A 1; 2; 3 B...
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
Enzyme(s) Bands observed (bp) 3000 3000 500, 2500 3000 A+B 250, 2750 A+C 250*, 2500 A +D 1250, 1750 A+C+D 250*. 1000. 1500 (note: * indicates very intense/bright bands) On the diagram below, construct a circular plasmid map of the plasmid consistent with the above data, showing: (i) The location of each enzyme cut site (11) The distances between the cut sites The single enzyme "B" cut site has been marked for you on the map at position "0" and...
A1
is my DNA, Enzyme 1 BsrB1
P1 is known pBR322 enzyme 1
A2 is my dna enzyme 2 RSa1
p2 is known pBR322 enzyme 2
Au is my dna uncut
Pu is know pBR322 uncut
ladder Pu Au P, A, P2 Az HAAAM .. - וור RESULTS: Analyzing your data Tobbul Avdinol Answer the following questions: 1) How many bands do you see in the "uncut" lanes? If there are more than one band can you explain the nature...
L= No restriction
B=Bam HI
E=EcoRI
H=Hind III
Band 1
27mm
31mm
29mm
29mm
Band 2
NA
34mm
41mm
37mm
Band 3
NA
41mm
46mm
43mm
Band 4
NA
43mm
49mm
52mm
Band 5
NA
46mm
57mm
71mm
Band 6
NA
NA
NA
76mm
Above is the actual measurements for the distance in mm. Please
plug this in with the existing chart located above
Gel Electrophoresis lab assignment The following sheets will be used to demonstrate your knowledge of gel...