This is about TNT in soil samples for a lab report.
1. What is the importance of the control sample? Describe the best way to collect control/reference soil samples at a crime scene. How would you ensure that a sample is representative?
This is about TNT in soil samples for a lab report. 1. What is the importance...
3. PCR analysis practice One 3) If you collect samples from crime scene and extract DNA out of each sample. Describe the technologies used to get the below results. 4) Identify which suspect is at the crime scene 5) Among suspect 1-3, who is homozygous for the tested locus and who is heterozygous? DNA from crime scene DNA ladder suspect DNA #1 #2 #3 500 bp 400 bp 300 bp 200 bp 100 bp — I 4. PCR Practice two...
For part 1 of this lab) I collected a soil sample from my campus Part 2) Tested bacteria initial viability Part 3) DNA extraction Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA sequence data analysis (sent sample to another lab) 1) What type of conclusions can be made from initially culturing on nutrient agar (e.g., qualitative assessment, quantitative assessment, preliminary, estimate, descriptive, or bacterial diversity)? 2) What...
What do you think about the importance of the content? How would you ensure that it meets the project requirements?
What items are necessary to include in an informative report? How about an analytical report? How do you plan to best present your report in a PowerPoint format? Explain the purpose of the preliminary documents of a report. Describe each informative and analytical report.
Skill Check DNA All in Our Genes SU2020) Protected ViewSaved to this PC- Design Draw Layout References Malings Review Help les from the Internet can contain vs. Unless you need to edit it's safe to stay in Protected View farah dowod . Activity 3: Analysis of Forensic Samples Crate Editing This photo is an actual photo of a gel that was run using the samples outlined in this lab From left to right Lane 1: A Hindi DNA digest used...
Take Test: Final Lab Report- UML tMy QUESTION 3 4pointsSave Answe When testing for complex sugars (starchl. your three samples are . Stach (a simple sugar postive control Water: negative control · Unknown: test sample When testing for complex sugars (starchl, your procedure is Put 10 drops of each sample into beakers Add 0.5 mL of lodine to each of your theee samples Following this test, you record these results: What do these results mean? How do you know? Sace...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
What would be the answer for #2 and 3? Lab report on Experiments 1 Your lab report should be in the required format described in the "Introduction" of the lab manual. 2. Figures 2, 3 and 4 with recorded data should be included in your lab report. 3. Tables 1 to 4 should be included in your lab report. 4. It is required that the answers to the questions listed in each data analysis and in "Questions and Exercises" should...
1. What crime did Sanger commit? What does the indictment and the language used to describe both Sanger's crime and her pamphlet reveal about beliefs of the time period? 2. What do you think Sanger hoped to accomplish with The Woman Rebel? What is "free motherhood?" Do you agree with Sanger's that birth control contributed to female independence and "free womanhood?" 3. Do you think Sanger's pamphlet was an effective way to disseminate information about birth control? Why, or why...
This is not a formal report Instead, please answer cach of the following questions in about five or six full sentences and provide academic references for your answers where indicated. Please submit your report on line 1. (12 points) Describe the Results (pattern of growth) of each experiment; use the questions as a guideline for summarizing your results (no drawings necessary). a) Heat resistance of soil bacteria > Was there a difference between the between the different heat treatments? b)...