Question

QUESTION 8 RNA is: O a) transcribed 3 to 5 on the template. b) the same as the template strand, except using U instead of T.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The correct answer is option c) the same as the nontemplate strand, except using U instead of T.

RNA is the same as the nontemplate strand, except using U instead of T. First of all, RNA is transcribed 5' to 3' on the template. RNA is complementary and antiparallal to template strand using G, A, C and U. DNA Template stand is used as a template to synthesize new transcript RNA. Whereas RNA is similar to the nontemplate strand, sequence of nontemplate strand and new RNA will be same, except using uracil instead of thymine. That's why nontemplate strand is also known as coding strand. In the following image a diagram is given for better understanding.d TTGATCA TAC TAGT DNA nontemplate strand 3 ATGATCA AU GAUCA FACTÅGT 1 nascenta template strand RNA 5 어 ANG AUC 3 RNA

Add a comment
Know the answer?
Add Answer to:
QUESTION 8 RNA is: O a) transcribed 3 to 5' on the template. b) the same...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...

    4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...

  • Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would...

    Question 2a If the DNA template 5′- ATGGATGC -3′ is transcribed to RNA, the RNA would be best described as... a. 3′- TACCTACG -5′. b. 5′- ATGGATGC -3′. c. 5′- AUGGAUGC -3′. d. 5′- UACCUACG -5′. e. 3′- UACCUACG -5′. Question 2b Which answer best summarizes how eukaryotic and bacterial RNA polymerases are different? a. Eukaryotes have several types of multimeric RNA polymerases, whereas bacteria only have one monomeric RNA polymerase. b. Eukaryotes have several types of RNA polymerases, one...

  • A C TA 4.) What is the RNA transcript given the following DNA Auracil repiaces +hymine...

    A C TA 4.) What is the RNA transcript given the following DNA Auracil repiaces +hymine RNA A,G,CU 5'- AGTCGTTGCC-3' Template strand 3'-TCAGCAACG-5' Nontemplate strand/3' UCA GCAACGG5 replace T with U a.)5'-AGUCGUUGCC-3' b.)5'-GGCAACGACU-3' c.) 3'-TCAGCAACGG-5' 3UCAGCAAC G G 5Twith U

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding...

    If a gene had the DNA sequence 5-GCTTGA-3' in the nontemplate (sense) strand of its RNA-coding region, what sequence would end up in the RNA when this gene is transcribed? Select one: a. 5'-CGAACU-3' b. 5'-AGUUCG-3' c. 5'-GCUUGA-3' d. 5'-UCAAGC-3' X

  • Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA...

    Question 4 1 pts What will be the RNA sequence that is transcribed from the DNA sequence below? 5' - TTACCGCTA - 3' (TEMPLATE STRAND) 3' - AATGGCGAT - 5' (CODING STRAND) 5'|TTACCGCTA | 3 5'TUAGCGGUAA3 5'UUACCGCUA13' 5'| TAGCGGTAA3

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’

    One strand of a section of DNA isolated from E. coli reads: 5’GTAGCCTACCCATAGG-3’ (a) Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? (b) What is the amino acid sequence of the proteins. (c) Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not. (d) If the T underlined in the above sequence was to...

  • QUESTION2 Which of the following statements is TRUE? O DNADNA hybrids and RNADNA hybrids are always...

    QUESTION2 Which of the following statements is TRUE? O DNADNA hybrids and RNADNA hybrids are always antiparallel O DNA is replicated using the template strand as the template but RNA is transcribed using the sense (or coding) strand as the template. O Both DNA and RNA polymerization require a primer O Introns get spliced out of DNA and out of pre-mRNA QUESTION 3 0. Which of the following statements is FALSE? O Only Eukaryote genes have an A/T rich core...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT