5. The corresponding t - RNA base sequence is 5'-U-U-A-3'
Loops are present in the structure of t-RNA ,where hydrogen bonds are not formed. One of them is recognition loop,the most specific loop. t-RNA are different due this loop. A specific sequence of 3 nucleotides is present at the end of this loop. It is known as Anticodon. There are total 61 types of anticodon that means 61 types of t-RNA. t-RNA recognizes its place on m-RNA with the help of anticodon by recognizing its complementary sequence on m-RNA ,known as codon. UUA is complementary to AAU.
6. The role of tRNA during translation is to carry amino acids to the mRNA for correct placement into the polypeptide chain.
DHU loop of tRNA helps to recognize specific aminoacyl synthetase enzyme which activates specific amino acids and attach it to the 3' end of tRNA ,also known as acceptor arm. There are total 20 amino acids and tRNA are specific for each amino acid. tRNA carries amino acid to the mRNA according to the codon and then polypeptide bonds are formed.
Stop codon are 3 in number UAA, UAG, UGA. They are recognized by termination factors or release factors. No tRNA is able to recognize stop codons by their anti codons.
Protein synthesis occurs on ribosomes in the cytoplasm. Disruption of DNA helix during transcription is done by the enzyme which breaks the hydrogen bonds between two strands.
d. glycosidic bonds e. Both a and care correct answers. 05. If a portion of a...
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
help 7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands and two old strands. Bone new and one old strand in each helix C)three new strands in one helix and three old strands in the second helix D)two new and one old strand in one helix and two old and one new strand in the second helix E two new strands in one helix and two old strands in the other helix. 8) A...
23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap of a properly modified mRNA B. transcription factors C. the anticodon of a properly formed aminoacyl tRNA D. the sequence of the coding strand E. all of the above 24. If the DNA code for a particular amino acid is 5'AGT3', then the anticodon on the tRNA would be A. 5'TCA3 B. 5'UCA3 C. 5'AGU3 D. 5'ACU3 E. 5'UCA3 25. What enzyme catalyzes the...
8. Glycolysis is a(n). A) five-step B) aerobic process C) catabolic D) anaerobic 9. The overall process of glycolysis A) produces CO B) is an anabolic pathway C) uses up 4 ATP molecules. D) produces 2 ATP molecules. 10. In step 9 of glycolysis, 2-phosphoglycerate is converted to phosphoenolpyruvate by a(n) reaction ) hydrolysis D) oxidation A) elimination B) addition 11. The nucleotides in the backbone of DNA are held together by A) phosphodiester B) hydrogen bonds D) peptide C)...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...
want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the initiation and termination codons of a certain protein amino acids in length. there of the protei nucleotides on a certain organism's chromosome; however ssuming that there has been no post-translational processing elined from this gene is translated, the protein product is only 250 A. The RNA was synthesized in a bacterial cell n, what can you conclude from these observations? The RNA was synthesized...
“Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...