Question

29. Which of the following changes would be expected if a CAUUUG sequence of bases mutated to CACUUG? a. The amino acid seque
1 0
Add a comment Improve this question Transcribed image text
Answer #1

Given Question is asking what will be expected if a CAUUUG sequences of bases mutated to CACUUG

A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or stop signal during protein synthesis

From the given table we can determine that

CAU code for histidine

UUG code for leucine

CAC code for histidine

As Mutation is in third Nucleotide of codon so its silent Mutation as both CAU & CAC code for histidine and there is no change amino acid synthesis

Hence given both sequences of bases ,code for same histidine and leucine amino acid

Hence option d is correct amino acid sequences will remain unchanged and other option can be eliminated

Plz upvote my answer Thank you!?

Add a comment
Know the answer?
Add Answer to:
29. Which of the following changes would be expected if a CAUUUG sequence of bases mutated...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...

    What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5'...

    There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...

  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...

    The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in predominant form found at pH = 0. b) What is the isoelectric point? c) What is the average charge on the population of peptide macromolecules at pH = 2.2? d) What is the average charge on the population of peptide macromolecules at pH = 12.5? TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...

  • You are given the below piece of Template DNA. What is the third amino acid in...

    You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • The DNA sequence below is copied from question 30 and has a mutation (highlighted in yellow)....

    The DNA sequence below is copied from question 30 and has a mutation (highlighted in yellow). TACGTACATACT 1) Transcribe the new sequence. 2) Translate the new sequence. What is the mutation? Original sequence: TACGTCCATACT Mutated sequence: TACGTACATACT (Glu) (Asp) Aspartic acid Glutamic acid Serine (Ser) Alanine (Ala) GU Jc Tyrosine (Tyr) A U Valine (Val) G А G Cysteine (Cys) с с U GTyptophan (Trp) START HERE Arginine (Arg) G U с A C Leucine (Leu) Serine (Ser) А с...

  • You are given the below piece of Template DNA (the same as the previous question). How...

    You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT