Homework Answers
Answer
- B. gel electrophoresis
Gel electrophoresis is a technique in which we seperate DNA, RNA and proteins based on their size or charge. Gel may made up of agarose so that DNA can travel through the pores of gel with the help of electric potential. Large sized DNA will travel smaller distance and small sized DNA will travel longer distance. DNA will get separated according to their size and we can compare them.
I hope this will help you if you like it then give me a thumbs up, thank you!
Add Answer to:
_______ _________ is a technique used to VISUALIZE DNA
fragments in a sample.
is a technique...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
Based on the migration of 3 DNA fragments {A, B, & C) of the indicated sizes...
Based on the migration of 3 DNA fragments {A, B, & C) of the indicated sizes (where kb = kilobases, ie thousand base pairs) in these gels, which of the following statements is correct? А В С А В С kb 0.5 Gel #1 Gel #2 Select one: a. Gell #1 has a higher % agarose than gel #2 b. An 8% acrylamide gel would give greater resolution of fragments larger than 500 bp than either of these gels. c....
Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the...
Which of the following answer(s) are true (select all that apply)? a)PCR results in exclusively the desired region to be amplified. b) PCR primers must be outside the region of interest. c) PCR primers must be flanking the region of interest. d) Sequencing primers must be flanking the region of interest. e) All of the nucleotides used in Sanger Sequencing would also be able to be used for a PCR reaction where you are trying to amplify a gene of...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction...
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...
Number of colonies: Plate LB, no DNA LB/ amp, no DNA uncountable LB/ amp, DNA (The two plated lab...
Number of colonies: Plate LB, no DNA LB/ amp, no DNA uncountable LB/ amp, DNA (The two plated labeled Bacteria DNA) 683 (70 ul) 291 (3011) (a) What quantity of DNA (in ng) was used in the transformation? (2 marks) (b) What fraction of the total transformation reaction was plated out? (2 marks) (c) How many transformants (colonies) were there in the total transformation reaction? (2 marks) (d) What was the transformation efficiency, expressed as transformants per ug of DNA...
Which of the following components is NOT used in the technique of PCR to amplify a...
Which of the following components is NOT used in the technique of PCR to amplify a specific DNA sequence in a mouse genome? O Specific single-stranded DNA primers O Double-stranded genomic mouse DNA O Heat-stable DNA polymerase D DNA ligase
The picture above represents an agarose gel that was used to analyze plasmid DNA after it...
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of...
The DNA primers used in PCR are a. complementary to DNA sequences at both ends of the DNA sequence of interest. b. attached to the gene of interest by ligase. c. produced when a gene of interest is read by restriction enzymes. d. identical to the entire base sequence of one strand of the DNA.
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
Based on the migration of 3 DNA fragments {A, B, & C) of the indicated sizes (where kb = kilobases, ie thousand base pairs) in these gels, which of the following statements is correct? А В С А В С kb 0.5 Gel #1 Gel #2 Select one: a. Gell #1 has a higher % agarose than gel #2 b. An 8% acrylamide gel would give greater resolution of fragments larger than 500 bp than either of these gels. c....
8. PCR is used to. A Diagnose genetic disease 8 Solve cnmes C Sudy gene unction D. All of th C ONA as a template to form RINA D All of the above 7. PCR technique does not need A. Tag polymerase B Restriion encymes C Olgoucletide prmers C. A fragment of skin D. All of the above 9 PCR can be used in A Cloning B.Sequening C.Medical dagnosis&foric mine 0.PCR can make mullple copies ot A. DNA B RNA...
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...
Number of colonies: Plate LB, no DNA LB/ amp, no DNA uncountable LB/ amp, DNA (The two plated labeled Bacteria DNA) 683 (70 ul) 291 (3011) (a) What quantity of DNA (in ng) was used in the transformation? (2 marks) (b) What fraction of the total transformation reaction was plated out? (2 marks) (c) How many transformants (colonies) were there in the total transformation reaction? (2 marks) (d) What was the transformation efficiency, expressed as transformants per ug of DNA...
Which of the following components is NOT used in the technique of PCR to amplify a specific DNA sequence in a mouse genome? O Specific single-stranded DNA primers O Double-stranded genomic mouse DNA O Heat-stable DNA polymerase D DNA ligase
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
Most questions answered within 3 hours.
-
MKT2283 Sales Management Week 2 Assignment
Making Sales Management Decisions – Pronto Retail
Centers
Sales Management,...
asked 5 minutes ago -
Uranium is distributed in a form called yellow cake, which is
made from uranium ore. In...
asked 16 minutes ago -
Python:
Write a func that will create a list of random numbers. The
function will take...
asked 19 minutes ago -
Which of the following statements below is correct? There might
be more than one correct answer....
asked 22 minutes ago -
You find that the annual standard deviation of a stock's returns
is equal to 35%. For...
asked 27 minutes ago -
A 2,000 kg car is traveling at 20.0 m/s down a long mountain
grade of 1.00%....
asked 34 minutes ago -
A baseball is hit almost straight up into the air with a speed
of 26 m/s...
asked 41 minutes ago -
In C++, what is the easiest way to have a program ask for first,
middle and...
asked 40 minutes ago -
1. When evaluating a source in a magazine, journal, newspaper,
or website, which one is NOT...
asked 49 minutes ago -
Write the vb.Net code that displays a 2-column table in a
textbox, displaying (1,2,3, ...., 100) in...
asked 53 minutes ago -
When 96.3 g of alanine C3H7NO2 are dissolved in 500. g of a
certain mystery liquid...
asked 56 minutes ago -
Mc Donald's and like natural ways of life have gigantic
financial support and a great deal...
asked 58 minutes ago