Option D
The RNA polymerase begins transcription from the promoter region which is usually located in the DNA, near the +1 start sites situated upstream on the DNA or towards the 5' region of the DNA. The transcription stops when the RNA polymerase encounters termination sequence in the gene. The mRNA strand then detaches from the polymerase and is released.
Transcription starts at the _______ sit on the ______ and ends at the ________ sequence. Transcription...
one
correct answer
Question 12 (1 point) What are the trans acting factors that control transcription in bacterial genes? O cap, start codon, stop codon. enhancers, silencers, operator, promoter, polyadenylation signal. 5 prime end of RNA, GU-splice site, branch point-A, AG-splice site, polyadenylation signal. O repressors, activators, cap, start codon, stop codon. O promoters, GU-splice site, branch point-A, AG-splice site, polyadenylation signal. enhancers, silencers, promoters, polyadenylation signal. repressors, activators. attenuators, Shine-Dalgarno sequence, start codon, stop codon attenuators, activator binding site,...
Hello. I need some help with these genetics questions. Id grealty
appreciate the help!
Question 11 (1 point) An Of C) mutation results in O no transcription. inducible transcription. transcription but no translation. no translation constitutive transcription. Question 12 [1 point) What are the trans acting factors that control transcription in bacterial genes? cap. start codon, stop codon. O enhancers, Silencers, operator, promoter, polyadenylation signal 5 prime end of RNA, GU splice site, branch point. A. AG-splice site, polyadenylation signal...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
Hello! I am working on this genetics problem and was wondering if
these two answers would make sense. Thank you for the help!
Question 1 (1 point) Saved Why can bacteria have poly-cistronic genes? Because they need multiple cistron organelles so they segregate evenly during cell division. Because they have many exons that are joined together before translation Because ribosomes can be loaded at multiple Shine Delgano/AUG sequences. Because ribosomes are loaded at the single CAP site. Because the stability...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
Which of the following might decrease the transcription of all genes in a bacterial cell? Select one: a. a decrease in the amount of sigma factor b. a decrease in the amount of RNA polymerase II c. a mutation that introduced extensive sequence changes into the DNA that precedes a single gene’s transcription start site d. a mutation that introduces a stop codon into the DNA that precedes the gene’s coding sequence
Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...