What is a stop codon complimentary to? 1. The stop codon is complementary to a tRNA...
What is a stop codon complimentary to?
1. The stop codon is complementary to a tRNA for one of the twenty amino acids
2.The stop codon is complementary to a tRNA for one of the three "special" amino acids that only bacteria use
3.The stop codon is complementary not to a tRNA but molecule called a termination factor
4.The stop codon is complimentary to the ribosomal sequence
Homework Answers
Answer:
3.The stop codon is complementary not to a tRNA but molecule called a termination factor
Explanation:
Stop codons are not complementary to any tRNA. When stop codons cause to terminate the protein synthesis.
Add Answer to:
What is a stop codon complimentary to?
1. The stop codon is complementary to a tRNA...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand...
The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand of nucleic acid that would be synthesized during transcription below the original strand. 2 pts) How many codons are in the alcohol dehydrogenase Rene? (1 pt) How many amino acids would be in the alcohol dehydrogenase enzyme? (1 pt) TRANSLATION 1 codon base pairs (1 pt) 1 codon amino acids (1 pt) 3 base pairs = amino acids (1 pt) A molecule of tRNA...
When a stop codon is in place at the ribosomal A site, a ________________ factor binds...
When a stop codon is in place at the ribosomal A site, a ________________ factor binds to the site instead of a new aminoacyl-tRNA. List two specific causes of DNA mutations. One of the ways chromatin remodeling occurs to allow gene expression is ____________________ of ______________ residues of histones. During translation, elongation factors EF-Tu and EF-G use hydrolysis of the energy molecule ________ to successfully complete their tasks The __________________________________ sequence is a consensus sequence (in prokaryotic mRNAs only) that signals...
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA...
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis? a. It is at the end of a mRNA molecule and terminates translation once the protein is completed. b. It prematurely terminates protein synthesis resulting in an incomplete protein. c. The 3 stop codons are UGA, UAG, and UGG. 2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site. The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A site of the ribosome. Aminoacyltransferase attaches the amino...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the initiation camnla bac formad [Choose ] Peptide bond formation between the polypeptide chain on the tRNA in the P site and the amino acid on the tRNA Translocation (the ribosome moves one codon toward the 3' end of the mRNA with the help of an elongation Step One ✓ The appropriate incoming aminoacyl-tRNA binds to an elongation factor bound to GTP The GTP is...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A) site of the ribosome Aminoacyltransferase attaches the amino...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
match 1. Cilia 2. Promoter 3. Flagellum 4. Microtubules 5. Codon 6. Termination signal 7. RNA...
match
1. Cilia 2. Promoter 3. Flagellum 4. Microtubules 5. Codon 6. Termination signal 7. RNA polymerase 8. Anticodon 9. Transcription factor 10. Centrioles A. A special base sequence on DNA which signals the end of transcription B. A three-base sequence or triplet on mRNA that provides the genetic information used in protein synthesis C. Long projections formed by the centrioles D. The enzyme in protein synthesis that breaks E. Start point of a gene being transcribed F. Short, cell...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand of nucleic acid that would be synthesized during transcription below the original strand. 2 pts) How many codons are in the alcohol dehydrogenase Rene? (1 pt) How many amino acids would be in the alcohol dehydrogenase enzyme? (1 pt) TRANSLATION 1 codon base pairs (1 pt) 1 codon amino acids (1 pt) 3 base pairs = amino acids (1 pt) A molecule of tRNA...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site. The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A site of the ribosome. Aminoacyltransferase attaches the amino...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the initiation camnla bac formad [Choose ] Peptide bond formation between the polypeptide chain on the tRNA in the P site and the amino acid on the tRNA Translocation (the ribosome moves one codon toward the 3' end of the mRNA with the help of an elongation Step One ✓ The appropriate incoming aminoacyl-tRNA binds to an elongation factor bound to GTP The GTP is...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A) site of the ribosome Aminoacyltransferase attaches the amino...
Question 9:
The genetic code is read in groups of three nucleotides, called
codons, in mRNA that specifies for a particular amino acid.
tRNA molecules act as the amino acid carriers that by correctly
pairing with the codon on mRNA can deliver the correct amino acid
to the ribosome during translation. At the tip of each tRNA
molecule is a group of three nucleotides called an anticodon and at
the other end is where the corresponding amino acid is attached...
match
1. Cilia 2. Promoter 3. Flagellum 4. Microtubules 5. Codon 6. Termination signal 7. RNA polymerase 8. Anticodon 9. Transcription factor 10. Centrioles A. A special base sequence on DNA which signals the end of transcription B. A three-base sequence or triplet on mRNA that provides the genetic information used in protein synthesis C. Long projections formed by the centrioles D. The enzyme in protein synthesis that breaks E. Start point of a gene being transcribed F. Short, cell...
Most questions answered within 3 hours.
-
39.4% of US homes continue to use a landline in addition to cell
phone service. 3...
asked 1 minute ago -
Starting with benzene, synthesize 1-phenyl-1-butyne.
Show intermediates and reagents.
asked 55 minutes ago -
Create a 32-run crossed array design with six control factors
and two noise factors such that...
asked 1 hour ago -
A 500g sample of sand from source A has the following amounts
retained on each sieve....
asked 1 hour ago -
In
your own words, please explain the essay by John Keynes wrote "The
End of Laissez...
asked 1 hour ago -
How are the matrix and pixels related? Why are smaller
pixels better for diagnostic quality?
asked 1 hour ago -
2. An AC generator has 80 rectangular loops on
its armature. Each loop is 11 cm...
asked 1 hour ago -
Please help me with this question. Consider Aldi’s current and
potential geographic markets (see Exhibit 4...
asked 1 hour ago -
What are the main components of the fermentation process and
give an explanation of each? Include...
asked 2 hours ago -
Explain which types of cells in the body (belonging to which
organs, etc.) are sensitive to...
asked 2 hours ago -
A single cable supports an 703-kg elevator car. What is the
tension in the cable when...
asked 2 hours ago -
among the three different ways to link CSS specifications to an
HTML document (inline CSS, document...
asked 2 hours ago