What is a stop codon complimentary to?
1. The stop codon is complementary to a tRNA for one of the twenty amino acids
2.The stop codon is complementary to a tRNA for one of the three "special" amino acids that only bacteria use
3.The stop codon is complementary not to a tRNA but molecule called a termination factor
4.The stop codon is complimentary to the ribosomal sequence
Answer:
3.The stop codon is complementary not to a tRNA but molecule called a termination factor
Explanation:
Stop codons are not complementary to any tRNA. When stop codons cause to terminate the protein synthesis.
What is a stop codon complimentary to? 1. The stop codon is complementary to a tRNA...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
The sequence of the gene for alcohol dehydrogenase is shown below. AATGCGTTTACCAAGCGTACAGTGTGCAAA Write the complementary strand of nucleic acid that would be synthesized during transcription below the original strand. 2 pts) How many codons are in the alcohol dehydrogenase Rene? (1 pt) How many amino acids would be in the alcohol dehydrogenase enzyme? (1 pt) TRANSLATION 1 codon base pairs (1 pt) 1 codon amino acids (1 pt) 3 base pairs = amino acids (1 pt) A molecule of tRNA...
When a stop codon is in place at the ribosomal A site, a ________________ factor binds to the site instead of a new aminoacyl-tRNA. List two specific causes of DNA mutations. One of the ways chromatin remodeling occurs to allow gene expression is ____________________ of ______________ residues of histones. During translation, elongation factors EF-Tu and EF-G use hydrolysis of the energy molecule ________ to successfully complete their tasks The __________________________________ sequence is a consensus sequence (in prokaryotic mRNAs only) that signals...
1. Which one of the following describes the NORMAL FUNCTION of a stop codon in mRNA during bacterial protein synthesis? a. It is at the end of a mRNA molecule and terminates translation once the protein is completed. b. It prematurely terminates protein synthesis resulting in an incomplete protein. c. The 3 stop codons are UGA, UAG, and UGG. 2. A tRNA with an ACC anticodon will insert the amino acid ________ during translation. (Use your codon sheet, Fig. 6...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site. The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A site of the ribosome. Aminoacyltransferase attaches the amino...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the initiation camnla bac formad [Choose ] Peptide bond formation between the polypeptide chain on the tRNA in the P site and the amino acid on the tRNA Translocation (the ribosome moves one codon toward the 3' end of the mRNA with the help of an elongation Step One ✓ The appropriate incoming aminoacyl-tRNA binds to an elongation factor bound to GTP The GTP is...
Place the events of Translation in bacteria into the correct order. The large ribosomal subunit associates with the small subunit and mRNA. The ribosome shifts along the mRNA in the 5' to 3' direction, moving the tRNA from the aminoacyl (A) site into the peptidyl (P) site The tRNA in the peptidyl (P) site shifts to the E site and leaves the ribosome. The next charged tRNA enters the open aminoacyl (A) site of the ribosome Aminoacyltransferase attaches the amino...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...
match 1. Cilia 2. Promoter 3. Flagellum 4. Microtubules 5. Codon 6. Termination signal 7. RNA polymerase 8. Anticodon 9. Transcription factor 10. Centrioles A. A special base sequence on DNA which signals the end of transcription B. A three-base sequence or triplet on mRNA that provides the genetic information used in protein synthesis C. Long projections formed by the centrioles D. The enzyme in protein synthesis that breaks E. Start point of a gene being transcribed F. Short, cell...