Homework Answers
Since template DNA strand is complementary and anti-parallel to the RNA produce with thymine at the place of uracil, the correct sequence of template would be-
3'-TATCCGTAAGCTAGGCCTATCGTA-5'
Your answer (option a) is correct
Add Answer to:
You have a segment of mRNA that contains the following sequence: 5-ALAGGCAUUCGAUCCGGAUAGCAU-3'. Which of the following...
Consider the following sequence (5’ – GUCCAUCA – 3’) that represents a segment of the mRNA...
Consider the following sequence (5’ – GUCCAUCA – 3’) that represents a segment of the mRNA produced by a virus. Suppose the virus was a negative-strand RNA virus. What would the corresponding genomic sequence be? 5’ – GUCCAUCA – 3’ 5’ – GTCCATCA – 3’ 3’ – CAGGTAGT – 5’ 3’ – CAGGUAGU – 5’ None of the above
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...
You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would...
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is...
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give...
If the sequence of an mRNA molecule is: 5' AUG CGA GUU CCG 3' a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3' ends are located) b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3' ends are located) c) Give the amino acid sequence.
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Most questions answered within 3 hours.
-
Recall that if X is a Student’s t random variable with n df,
then by definition...
asked 11 minutes ago -
A charge of -2.95 µC is fixed in place. From a horizontal
distance of 0.0470 m,...
asked 8 minutes ago -
Consider the following information:
Your company makes widgets. You are trying to figure out what
volume...
asked 10 minutes ago -
Math 333 Plz help ASAP
The yield of a chemical process is being studied. From previous...
asked 27 minutes ago -
Cobb-Douglas Preferences: Cobb-Douglas preferences on the
consump-
tion set R2+ can be represented by a utility...
asked 22 minutes ago -
In your experience, what are some of the barriers to the
successful implementation of a project?...
asked 26 minutes ago -
1. A normal distribution has a mean of
μ = 60 and a standard deviation
of...
asked 28 minutes ago -
The size of your Social Security benefits is determined by:
(select all that apply) Question 1...
asked 40 minutes ago -
Starch polymers are broken down by enzymes into monomers
called:
a.)maltose
b.) dextrins
c.) glucose
d.)...
asked 47 minutes ago -
How does HA (High Availability) work and name two ways it can
help an organization?
asked 49 minutes ago -
Saginaw Company is a garden products wholesale firm. In
December, Saginaw Company expects to sell 26,000...
asked 49 minutes ago -
Write a program for the management of a bookstore in java,
WITHOUT THE USE OF BOOK...
asked 50 minutes ago