Consider the following sequence (5’ – GUCCAUCA – 3’) that represents a segment of the mRNA produced by a virus. Suppose the virus was a negative-strand RNA virus. What would the corresponding genomic sequence be?
5’ – GUCCAUCA – 3’
5’ – GTCCATCA – 3’
3’ – CAGGTAGT – 5’
3’ – CAGGUAGU – 5’
None of the above
Answer - 3’ – CAGGUAGU – 5’
Explanation - The negative-sense viral RNA is complementary to mRNA (messenger RNA) like DNA and the positive-sense viral RNA nucleotide sequence is similar to that of mRNA .
Segment of mRNA = 5’ – GUCCAUCA – 3’
The mRNA is complementary to RNA (RNA is negative sense).
The nucleotide sequence of RNA = CAGGUAGU
Uracil is present in RNA instead of thymine nitrogen base that present in DNA. The RNA should have 3' - 5' polarity, because the negative-sense (or antisense) RNA sequence and mRNA sequence are complementary with each other.
So, the RNA sequence will be - 3’ - CAGGUAGU - 5’
Consider the following sequence (5’ – GUCCAUCA – 3’) that represents a segment of the mRNA...
You have a segment of mRNA that contains the following sequence: 5-ALAGGCAUUCGAUCCGGAUAGCAU-3'. Which of the following ONA molecules would be the template strand from which this segment of mRNA was produced? 3-TATCCGTAAGCTAGGCCTATCGTA 5 3'-TACGATAGGCCTAGCTTACGGATAS 3 AUCGUAUCCGGAUCGAUGCCUAUS none of the above
Consider the following segment of DNA is part of a gene, Left 5'.... ACTGACTGACAGTC..3' 3'.... TGACTGACTGTCAG... 5' RIGHT during RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please predict the peptide sequence(s) produced from the mRNA transcribed from this segment of DNA. (Hint: First determine the mRNA sequence, then use the genetic codon table to...
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
19. If a DNA sequence states: 5'-GCTTCCCAA-3 3'-CGAAGGGTT-5 nd assume the top strand is the template strand used by RNA polymerase, what is the corresponding mRNA sequence? A.5'-GCUUCCCAA-3' C.5'-UUGGGAAGC-3 B. 3'-UUGGGAAGC-5 D. 5-TTGGGAAGC-3 E.3-TTGGGAAGC-5
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2
15. Determine the amino acids following mRNA molecules. ne the amino acid sequence a ribosome would translate from the *GCACCAUGCAAAGCGGGGAUUAGACCUUU-3 Caution: from which end of the RNA strand does the ribosome begin translating? 3-AGAGUCCAUGCAAAGCGGGGAUUGUACCUUU - 5' 16. Determine the amino acid sequence a ribosome would translate from the following non template DNA strand. (Hint: you must first convert the non template DNA strand to a template DNA strand and then to mRNAJ 3'-ACCTTGATCCTTGACGTATGTAGTATGTATC-5'
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3'CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5 GUACCUGUCcauucuuauguugugucCAGCCGUACUGC What would be the immatur RNA sequence transcribed...