If a fragment produced by one enzyme disappears when the DNA is treated with that same...
If a fragment produced by one enzyme disappears when the DNA is treated with that same enzyme plus another enzyme, what does this signify?
Homework Answers
It means the restriction site of first enzyme is contained in the restriction site of the other enzyme.
Please rate.
Add Answer to:
If a fragment produced by one enzyme disappears when the DNA is
treated with that same...
What enzyme activities and DNAs are required to clone a fragment of mouse DNA?
What enzyme activities and DNAs are required to clone a fragment of mouse DNA?
Easy question Given that a DNA fragment law the end (on right): Which one of the...
Easy question
Given that a DNA fragment law the end (on right): Which one of the following DNA ends is com, Place the following steps in chronological order when creating a tomato genomic DNA library. The available materials are DNA ligase, restriction enzyme, tomato leaves, plasmid DNK to act as vector that has already been digested with the restriction enzyme, competent bacteria, and nutrient agar plates containing ampicillin. You may use a step more than once. Add DNA ligase Transform...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone,...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site...
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
The following fragment of DNA was sequenced and then treated with sodium bisulfite. Compare both sequences...
The following fragment of DNA was sequenced and then treated with sodium bisulfite. Compare both sequences and determine which Cytosines were originally methylated and which were not. The presence of methylated cytosines should be indicated including an asterisk (*) after each methylated cytosine. Untreated ACTACCATGGCGCTT Treated ACTATCATGGCGTTT AC CACC ACGGC GCCC ACCPAC CAC GGCGCC*C o ACTACCATGucccтт CAC TACC"ATGGC"GC
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme,...
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment) has the same restriction sites on each end, there are t...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You...
You are given a circular DNA molecule to analyze that is 3,000bp
(3 Kb) long. You proceed to treat the DNA molecule with different
cutting enzymes and then you run the individual reactions on a gel.
The following gel is produced with each column representing a
different reaction (lane). In lane 1 a molecule weight ladder is
run. In lane 2, the circular DNA is NOT treated with any enzyme. In
lane 3 the DNA is treated with an enzyme...
A T4 bacteriophage transfers a random fragment of DNA from one E. coli cell to another...
A T4 bacteriophage transfers a random fragment of DNA from one E. coli cell to another E. coli cell. This phenomenon is an example of a. conjugation b. transformation c. transduction d. none of the above
Easy question
Given that a DNA fragment law the end (on right): Which one of the following DNA ends is com, Place the following steps in chronological order when creating a tomato genomic DNA library. The available materials are DNA ligase, restriction enzyme, tomato leaves, plasmid DNK to act as vector that has already been digested with the restriction enzyme, competent bacteria, and nutrient agar plates containing ampicillin. You may use a step more than once. Add DNA ligase Transform...
A linear DNA molecule that is 3250 bp long is digested with restriction enzyme A alone, restriction enzyme B alone, or a combination of enzymes A and B to produce the following fragment sizes. Construct a restriction map of the DNA fragment. How many times does enzyme A cut the linear DNA molecule? If you are unable to place both enzymes A and B on the map, show one possible arrangement of enzyme A cognition sites on the DNA molecule.
The following fragment of DNA was sequenced and then treated with sodium bisulfite. Compare both sequences and determine which Cytosines were originally methylated and which were not. The presence of methylated cytosines should be indicated including an asterisk (*) after each methylated cytosine. Untreated ACTACCATGGCGCTT Treated ACTATCATGGCGTTT AC CACC ACGGC GCCC ACCPAC CAC GGCGCC*C o ACTACCATGucccтт CAC TACC"ATGGC"GC
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
You are given a circular DNA molecule to analyze that is 3,000bp
(3 Kb) long. You proceed to treat the DNA molecule with different
cutting enzymes and then you run the individual reactions on a gel.
The following gel is produced with each column representing a
different reaction (lane). In lane 1 a molecule weight ladder is
run. In lane 2, the circular DNA is NOT treated with any enzyme. In
lane 3 the DNA is treated with an enzyme...
Most questions answered within 3 hours.
-
Consider the quantum number sets listed below.
What is the name of the smallest element for...
asked 1 hour ago -
In python,write a function nameSet(first, last) that takes a
person's first and last names as input,...
asked 3 hours ago -
How do you think we should value management? Specifically how
might we try to determine MRPL...
asked 3 hours ago -
Suppose the Central Bank of Turkey starts to pay
interest on reserves. Under what circumstances this...
asked 3 hours ago -
For Bergson the concept of Being contains less reality than does
the concept of Becoming. True...
asked 4 hours ago -
What is the hydroxide ion concentration, [OH-], in a solution
with a hydronium ion concentration, [H3O+]...
asked 4 hours ago -
What species is the reducing agent in the following
equation?
Mg(s) + 2HCl (aq) --> MgCl2(aq)...
asked 4 hours ago -
A 50g ice cube is taken out of a freezer at 0 degrees Celsius
and put...
asked 6 hours ago -
How do ratios help you determine trends? What specific
information do managers look at? Is there...
asked 6 hours ago -
A wavelength of 514 nm is used to find an unknown diffraction
grating. If the separation...
asked 6 hours ago -
Use the central limit theorem to find the mean and standard
error of the mean of...
asked 7 hours ago -
You will be given a file that will contain averages for classes
which are divided into...
asked 7 hours ago