How do DNA sequences change protein structure and what are some affects to the protein
structures that can have an effect on the PTC receptor?
The protein sequence is determined by the DNA of the gene that can encode the protein. A change in the DNA gene sequence might lead to a change in the series of amino acids of the protein.
PTC tasting, is also called as phenylthiocarbamide tasting. It is a controlled genetically to taste phenylthiocarbamide and a number of similar substances, that have some activity of antithyroid.
The shape of the protein receptor determines how tightly it is bound to phenylthiocarbamide (PTC). All persons have two copies of every gene that are having the combinations of the bitter taste gene variants, which can determine whether someone finds PTC somewhat bitter, intensely bitter, or without taste at all.
The degree that shows differences in the phenylthiocarbamide receptor might affect the other tastes.
Computational tools are used to generate models of the receptor bound to phenylthiocarbamide (PTC) ligand to estimate binding sites and binding energies. In these models, phenylthiocarbamide (PTC) binds at a distant site from the amino acids (variants), and PTC binding energy that was equal for both the nontaster and taster forms of the protein. This models says that the inability of humans to taste phenylthiocarbamide (PTC) is due to a failure of G-protein activation rather than the decreased binding affinity of the receptor for PTC.
How do DNA sequences change protein structure and what are some affects to the protein structures...
How can we use comparisons of DNA sequences, protein sequences, chromosome banding patterns, and genome sequences between different species to learn about origins and evolution?
What do you notice about the divergence of the amino acid (protein) sequences when compared to the nucleotide (DNA) sequences? Given a large section of a gene, say a complete exon, how could you determine reading frame?
Firstly I could do with a brief description of mitochondrial DNA. How does the structure of DNA in mitochondria compare to animal DNA (for the sake of simplicity let's say human - some animals might have unusual DNA structure) and what living organism is the mitochondrial genome most akin to? (Circular like bacteria maybe?) and are the mitochondria within a single human homogenous? Secondly, and most importantly to my aim, does the mitochondrial genome recombine in anyway? Is the process...
Describe how homologous recombination can change DNA sequences by gene conversion vs. how it can cause deletions/insertions.
How many different DNA sequences can be generated from a DNA sequence composed of 15 nucleotides (A, T, C or G)? How many different “biological information” can be produced from a protein sequence consisting of 15 amino acids?
What can SNPs do to wild-type sequences of DNA if they have mutations in base pairing?
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Question 18 4 pts What role do restriction enzymes play in bacteria? How do bacteria protect their own DNA from the action of restriction enzymes? Change the surface proteins of bacteria; since DNA is not protein, there is no need for protection Cut foreign DNA into pieces; bacteria have RNA genomes. Destroy invading viral DNA: bacterial DNA does not contain the restriction enzyme recognition sequences. Restrict the growth rate of bacteria; bacterial DNA is restriction enzyme resistant. Question 18 4...
A single nucleotide deletion in the DNA causes a protein change in sequence from Ser – Thr – Ile – Ser – Gly – Ala – Arg – Leu To Ser – Thr – Leu – Ala – Glu – Pro – Val What are the old and new mRNA nucleotide sequences?
how the protein structure surrounding the heme affects the relative affinity for oxygen vs. carbon monoxide.