lethal gene is present in the multiple cloning site,
a) if there is no DNA insert
there is no DNA insert in the MCS, so the lethal gene is intact, it is transcribed and translated to produce the protein product, which causes the death of the cell, so those cells which have taken the plasmid without the insert dies.
b) with a DNA insert
MCS is digested using the restriction enzymes and the DNA is inserted into the MCS, the inserted DNA disrupts the lethal gene, so functional RNA or protein is not produced from the lethal gene, so it cannot cause the death of the cells so those cells which have taken the plasmid with the DNA insert are viable.
so lethal gene in the MCS helps us to select those cells which have taken the plasmid with the insert.
Explain how the lethal gene in the plasmid's multiple cloning site(MCS) will function with and without...
Q1) Which of these best describes the multiple cloning site (MCS)? (1 mark) Select one: a. A sequence of DNA which can be used in agarose gel electrophoresis to determine the size of DNA molecules. b. A sequence of DNA which contains recognition sites for many restriction endonucleases. c. A sequence of DNA used to identify and/or select for transformed cells. d. A sequence of DNA which initiates replication and from which DNA replication proceeds. e. A sequence of DNA...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
4. During cloning we insert an ampicillin resistance gene a plasmid, (a) Explain its function in the cloning experiment. (b) Sketch and explain what would occur if you plate your post-cloning specimens on (1) a plate with methicillin and (ii) ampicillin? Explain the results in your sketch.
You cut a gene of interest with HincII and would like to insert it into the multiple cloning site (MCS) of a plasmid. The plasmid's MCS contains the cut sites listed below. Which of these sites could you use to insert the gene of interest? Select all that apply. GTC*GAC 1. CAG*CTG G*TYRAC 2. CARYT*G GT*CGAC 3. CAGC*TG GGT*ACC 4. CCA*TGG GTA*TAC 5. CAT*ATG none of these sites
Early gene cloning experiments involved insertion at one restriction site in the vector; for example, the insert would have and EcoRI site at each end, and he vector would be opened at an RI site prior to litigation. Under what circumstances would asymmetric cloning be desirable, with the insert having a different site at each end? Please only typed replies and provide source where information was obtained. Thanks
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
Which of the following characteristic is not present in a plasmid on a general basis?a) Multiple cloning site (MCS)b) Origin of replication (ori)c) Antibiotic resistance gened) Beta galactose genes
The purpose of including an ampicillin resistance gene in a plasmid into which you are cloning a piece of DNA is: This is used to prevent expression of other ampicillin resistance genes in the bacterial genome. This enables the creation of ampicillin-resistant bacteria for biomedical research. This enables selecting a bacteria colony transformed with a plasmid with a DNA insert ligated in as a means of amplifying a specified piece of DNA. This enables selecting a bacterial colony transformed with...
Antibiotic selection allows you to determine which bacteria contain the plasmid of interest, but do not necessarily tell you if the plasmid has taken up the recombinant DNA and contains your gene of interest. Which gene, which spans the multiple cloning site (MCS), allows you to screen for plasmids that contain your insert? A. β-lactamase (bla) B. Ori C. lacZ D. X-gal
Explain how to identify causative mutations in single-gene Mendelian disorders using genetic markers, positional cloning and DNA sequencing eg hearing loss, neurofibromatosis, inflammatory bowel disease