soil conservation practice what is the technique name with a description that states 5 year sequence for planting, or this technique helps fertility and erosion control?
Solution:-
Soil fertility and sustainable agriculture practitioners know that most soils today need their health and vitality rebuilt. In times past, nature built healthy, vital soils, and there is value in copying nature in rebuilding soil health. However, we cannot afford to take millions of years to do so as nature did — we need intelligent intervention. Cultivation, grazing, composting, soil conservation, green manuring, soil testing, soil remineralization, fertilizer priorities, fossil humates, and visual soil assessment all play a role in establishing self-regenerative, self-sufficient, fertile soils.
The biological activities at the basis of self-regenerative soil fertility occur at the surfaces of soil particles where minerals come into contact with water, air, and warmth. It is at these surfaces that biological activities provide nitrogen fixation and silicon release.
Actually, there's a very good — and scientific — reason for farmers to plant different crops in a field from year to year. It's a process known as crop rotation, and it's actually been around a long, long time.
Crop rotation refers to the practice of growing different types of crops (or none at all) in the same area over a sequence of seasons. Historians believe farmers in the Middle East practiced crop rotation as early as 6,000 B.C., although they didn't fully understand the science behind it.
So what's wrong with planting the same crop in the same field season after season? As farmers thousands of years ago learned, several problems begin to creep up when you don't rotate crops. All of these problems can lead to decreased yields over the course of several years.
First, the land itself can become “tired" and less fertile. This is because the same type of crop planted repeatedly in the same area keeps draining the land of the same nutrients needed for that plant's growth. Second, certain pests can reach levels that are hard to control when they learn to make a home near a field that always has the same type of crop. Finally, land can be more susceptible to the forces of erosion if the same type of crop is planted repeatedly season after season.
Crop rotation helps mitigate each of these effects. Different types of plants require different types of nutrients from the soil. Changing crops routinely allows the land to remain fertile, since not all of the same nutrients are being used each season. For example, planting a legume, such as soybeans, helps to replenish necessary nitrogen in the soil.
In the past, not planting anything (also called leaving the field fallow) allowed the land to rest and replenish its nutrients. Some modern farmers will occasionally allow fields to lie fallow to rest, but crop rotation has helped to increase productivity by replacing fallow periods with growing different crops that replenish soil nutrients.
Crop rotation also helps to battle against the forces of erosion. Rotating crops helps to improve soil stability by alternating between crops with deep roots and those with shallow roots. Pests are also deterred by eliminating their food source on a regular basis.
Today, exactly how crops are rotated depends upon many factors, including the type of soil, the climate, precipitation, and the markets for various crops. Some modern farmers may rotate corn and soybeans in a single field on alternate years. Other farmers may rotate six or more crops in a field over multiple years.
soil conservation practice what is the technique name with a description that states 5 year sequence...
soil conservation which technique states follows the hill?
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
Case Study on Kudzu plants question 3,4, and 5 Sat Mar 28 kudzu case study.pdf 3. If kudzu was shipped all over the United States, why is it only prevalent in the Southeast? Why did it not establish itself all over the country 4. List some pros and cons of kudzu in the chart below. Pros Cons Rapid Growth and root system Rapid growth, hard to control Helps the erosion Invasive species Large leaves and sweet aramotic blooms Uses the...
It's All in Your Approach Quiz Name: 7. There are 5 types of connections with People: Verbal, Physical, Emotional, Individual and A. Visual B. Holistic c. Nurturing 8. The hand under hand technique helps the resident to also assist with the task and may prevent skin tears and bruising to the resident. True or False Part 2 9. Help them use what abilities they still have left and focus on what they can no longer do. True or False 10....
A 48-year-old woman is admitted to the emergency room. Her family states she has been ill for 5 days with vomiting and diarrhea and most recently has presented in a coma. The family states she has lost weight over the last month in spite of the fact she has had an increase appetite and thirst as well as urination. She has no past major medical problems. She takes no medications. On physical examination: BP 110/80, P 96, R 22, BMI...
CCSF Introductory Statistics Econ. 5 Chapter 10 Practice Assignment Name: Harry's Hamburgers claims that the residents of Harryville eat at the hamburger chain an average of exacty 18 6mes per year. You took a sample of 48 residents of Harryvile and found that the sample mean was 17. The sample standard deviation was 4.5. You want to test to see if Harry's claim can be dasputed with a significance level o o.05 1. For each number in with that number...
Stephen, MN heveUSDOT 0 Betsy Jensen stands near one of the farm trucks parked at the family farm near Stephen, Minn., on Monday. Dan Gunderson | MPR News Now that spring has finally arrived in Minnesota, the Jensen family is scrambling to get crops planted on their northern Red River Valley farm. But the usual optimism of a spring planting season is tempered this year by worries about the ongoing trade dispute between the United States and China. China has...
1 For the following description of data, identify the W's, name the variables, specify for each variable whether its use indicates it should be treated as categorical or quantitative, and for any quantitative variable identify the units in which it was measured (or note that they were not provided). Specify whether the data come from a designed survey or experiment. Are the variables time series or cross-sectional? Report any concerns you have as well. A certain horse race has been...
Stephen, MN heveUSDOT 0 Betsy Jensen stands near one of the farm trucks parked at the family farm near Stephen, Minn., on Monday. Dan Gunderson | MPR News Now that spring has finally arrived in Minnesota, the Jensen family is scrambling to get crops planted on their northern Red River Valley farm. But the usual optimism of a spring planting season is tempered this year by worries about the ongoing trade dispute between the United States and China. China has...
NAME: Class Learning Activity #1 NURSING 110: CONCEPTS & PRACTICE I CONCEPT MODELI: UNIT H: ELIMINATION AND DIGESTION Pediatric Diarrhea Case Study Bobby is a 5-year-old white male who has been experiencing several bowel movements/day for the last 2 weeks. He is an active child who enjoys swimming and playing outside with his 2 older sisters. His Mom brings him to the primary care office today because he has lost 2 lbs in the last week and has been more...