If a protein binds to a DNA sequence downstream of a promoter, transcription is enhanced. Which site is likely to be attached?
If a protein binds to a DNA sequence downstream of a promoter, transcription is enhanced. Which...
A protein binds a DNA sequence downstream of a promoter. This results in an increased rate of transcription of the gene. Which of the following site is likely to be attached? a. Operon b. Terminator c. Activator binding site d. Promotor The following are produced by algae To prepare the insert for the gene cloning, you need to find a proper source of the DNA fragment. PCR is one of the most common ways to get the gene that you...
Suppose there is a protein "A" which binds to a DNA sequence and increases transcription of the gene CBC23. In the presence of molecule "C", protein "A" changes structure and can no longer bind to the DNA sequence, resulting in reduced transcription of CBC23. What terms describe "A" and "C" respectively? Enhancer and activator Repressor and Effector Effector and activator Activator and enhancer Polymerase and activator Activator and effector
The TATA binding protein binds to _______________. the promoter in eukaryotes. the promoter proximal element. the +1 transcription start site the promoter in prokaryotes.
What is an operon? Choose one: A. a short sequence of DNA to which a transcription regulator binds B. a set of genes that is constitutively active C. a sequence of DNA that produces a variety of mRNAs RD. a set of genes controlled by the binding of two or more transcription regulators E. a set of genes transcribed as a single mRNA from a single promoter
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
17) Once a protein binds to DNA at a specific site a) Transcription may be blocked b) RNA polymerase may bind more efficiently c) RNA polymerase may be unable to transcribe the gene d) Transcription may be activated e) All of these choices may result
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
(2) In isolation, a DNA-binding protein binds to its regulatory sequence with a Kd of 1.0 M. Another DNA binding protein binds to another sequence on the same DNA a few bases away with a Kd of 5.0 HM when alone. The two proteins each have a domain which binds to the other with an interaction energy of -2.7 kcal/mole: (a) Draw the thermodynamic box which represents all four states of this system (b) what are the affinities for each...
What additional genetic experiments would you suggest to verify that this region of cloned DNA contains a functional promoter? Select the two correct answers. -Insert the sequence downstream of the coding sequence for a protein whose expression is easy to assay and then introduce that chimeric construct into cells and assay for protein expression. -Use a known, control promoter to confirm that the protein-coding sequence is correct and that the protein can be detected in the cells used. -Sequence the...
Transcription starts at the _______ sit on the ______ and ends
at the ________ sequence.
Transcription starts at the sequence. site on the and ends at the O'A AUG start codon, RNA, termination Promoter, RNA, Termination Promoter, RNA, STOP O D. Promoter, DNA, Termination